CAMK2D ANTISENSE OLIGONUCLEOTIDS AND THEIR USES

专利摘要:
the present invention relates to antisense oligonucleotides that target camk2d mrna in a cell, leading to reduced expression of the camk2d protein. reducing the expression of the camk2d protein is beneficial for the treatment of certain medical disorders, for example, diseases or associated cardiovascular disorders.
公开号:BR112020016347A2
申请号:R112020016347-3
申请日:2019-02-21
公开日:2021-01-12
发明作者:Richard E. Olson；Brian R. Anderson；Peter Hagedorn；Marianne Lerbech Jensen；Ivar M. McDonald；Stephen E. Mercer
申请人:Bristol-Myers Squibb Company；Roche Innovation Center Copenhagen A/S；
IPC主号:

专利说明:

[0001] [0001] The content of the sequence listing submitted electronically (Name: 3338_102PC04_SequenceListing_ST25.txt; Size: 746,302 bytes; and Creation Date: February 20, 2019) presented in this application is incorporated into this document by reference in its entirety. DESCRIPTION FIELD
[0002] [0002] The present description refers to antisense oligomeric compounds (ASOs) that target the transcription of delta II-type calcium / calmodulin-dependent kinase (CAMK2D) in a cell, leading to reduced expression of the CAMK2D protein. The reduction in the expression of the CAMK2D protein can be beneficial to a variety of medical disorders, such as diseases or associated cardiovascular disorders. BACKGROUND
[0003] [0003] Calcium-dependent serine / threonine kinases / calmodulin (Ca2 + / CaM) (CaMKs) constitute a family of 81 proteins in the human proteasome that play a central role in cell signaling, transmitting Ca2 + signals. Four CaMKII isoenzymes (α, β, γ and δ), in addition to about 30 excision variants, are expressed in humans. Braun, A.P., et al., Annual Review of Physiology 57: 417-445 (1995). Of these, the CaMKIIδ protein (“CAMK2D”) is the most abundant isoform in the heart and plays an important role in the excitation-contraction (ECC) coupling and relaxation processes of normal cardiac physiology. Mattiazzi A., et al., Am J. Physiol Heart Circ Physiol 308: H1177-H1191 (2015). CAMK2D activity has also been described as being important in the recovery process after a certain heart-related injury (for example, ischemia-reperfusion injury). Said M., et al., Am J. Physiol Heart Circ Physiol 285: H1198-205 (2003).
[0004] [0004] Despite several scientific advances, heart-related diseases continue to be the leading cause of death for men and women worldwide. The American Heart Association estimates that by 2030, almost 40% of the U.S. population will have some form of cardiovascular disease and direct medical costs are expected to reach $ 818 billion. See Benjamin, E.J., et al., Circulation 135: e146-e603 (2017). However, Mattiazzi et al. notes that "the ubiquitous nature of CaMKII and its effects on different protein targets challenge the use of CaMKII inhibitors as a therapeutic tool". Am J Physiol Heart Circ Physiol 308: H1177- H1191 (2015). Therefore, new treatment options that are much more powerful and economical are highly desirable. DESCRIPTION SUMMARY
[0005] [0005] The present description is directed to an antisense oligonucleotide (ASO) comprising, consisting essentially of, or consisting of the sequence of contiguous nucleotides 10 to 30 nucleotides in length that is complementary, as well as fully complementary, to a sequence of nucleic acids in a delta type II calcium / calmodulin-dependent protein kinase transcription (CAMK2D). In some embodiments, the ASO of the present description, or its contiguous nucleotide sequence, is at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100 % complementary to the nucleic acid sequence within the CAMK2D transcript. In some embodiments, the CAMK2D transcript is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
[0006] [0006] In some embodiments, ASO in the present document described is able to reduce the expression of the CAMK2D protein in a human cell (for example, HEK293 cell) which is expressing the CAMK2D protein. In some embodiments, the expression of the CAMK2D protein is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100% compared to the expression of the CAMK2D protein in a human cell that is not exposed to ASO.
[0007] [0007] In some embodiments, ASO is able to reduce the expression of the CAMK2D transcription (eg, mRNA) in a human cell (eg, HEK293 cell) that is expressing the CAMK2D transcript. In some embodiments, the expression of CAMK2D transcription is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the expression of the CAMK2D transcript in a human cell that is not exposed to ASO.
[0008] [0008] In some embodiments, the ASO described in this document is a gapmer. In some modalities, ASO has a design of LLLDnLLL, LLLLDnLLLL, or LLLLLDnLLLLL, where L is a nucleoside analog, D is DNA, and n can be any integer between 4 and 24. In some modalities, n can be any number integer between 6 and 14. In some embodiments, n can be any integer between 8 and 12.
[0009] [0009] In some embodiments, the ASO nucleoside analog described herein comprises a 2'-O-alkyl-RNA; 2'-O-methyl-RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluro-RNA; 2'-fluoro-DNA; arabic nucleic acid (ANA); 2'-fluoro-ANA; or bicyclic nucleoside analog (LNA). In some embodiments, one or more of the ASO nucleoside analogs is a sugar-modified nucleoside. In some embodiments, the sugar modified nucleoside is a 2 'sugar modified nucleoside that increases affinity. In some embodiments, one or more of the nucleoside analog comprises a nucleoside containing a bicyclic sugar. In some embodiments, the 2 'sugar-modified nucleoside that increases affinity is an LNA. In some embodiments, the LNA is selected from the group consisting of ethyl nucleoside restricted (cEt), 2'-O-methoxyethyl 2 ', 4'-restricted (cMOE), α-L-LNA, β-D-LNA , 2'-O, 4'-C-ethylene (ENA), amino-LNA, oxide-LNA, thio-LNA or any combinations thereof. In some embodiments, the ASO comprises one or more 5'-methylcytosine nucleobases.
[0010] [0010] In some embodiments, the ASO in this document described is capable of (i) reducing the level of mRNA encoding CAMK2D in human inducible Pluripotent Stem Cell Derivative (hiPSC-CM); (ii) reducing the level of CAMK2D protein in hiPSC-CM; (iii) reduce, improve or treat one or more symptoms of a cardiovascular disease or disorder, and (iv) any combinations thereof.
[0011] [0011] In some embodiments, the ASO contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising (i) nucleotides 625 - 842 of SEQ ID NO: 1; (ii) 1,398 - 59,755 nucleotides of SEQ ID NO: 1; (iii) nucleotides
[0012] [0012] In some embodiments, the ASO contiguous nucleotide sequence comprises SEQ ID NO: 4 to SEQ ID NO: 1713 with one or two incompatibilities. In some embodiments, the ASO contiguous nucleotide sequence comprises the nucleotide sequence selected from the sequences in Figures 1A and 1B (SEQ ID NO: 4 to SEQ ID NO: 1713). In some embodiments, the ASO contiguous nucleotide sequence comprises SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 114, SEQ ID NO: 158, SEQ ID NO: 190, SEQ ID NO: 327, SEQ ID NO: 463, SEQ ID NO: 513, SEQ ID NO: 516, SEQ ID NO: 519, SEQ ID NO: 657, SEQ ID NO: 659, SEQ ID
[0013] [0013] In some embodiments, the ASO of this description has a designer selected from the group consisting of the drawings in FIGURE 3, in which the capital letter is a sugar-modified nucleoside and the lower letter is DNA.
[0014] [0014] In some embodiments, the ASO described in this document is able to reduce the expression of the CAMK2D protein in a hiPSC-CM cell that is expressing the CAMK2D protein. In some embodiments, the expression of the CAMK2D protein is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% compared to a cell not exposed to ASO. In some embodiments, ASO is able to reduce the expression of the CAMK2D transcription (for example, mRNA) in a hiPSC-CM cell that is expressing the CAMK2D transcription. In some embodiments, the expression of CAMK2D transcription is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a cell not exposed to ASO.
[0015] [0015] In some modalities, the ASO is 14 to 20 nucleotides in length. In some embodiments, the ASO nucleotide sequence comprises one or more modified internucleoside bonds. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of internucleoside bonds are modified. In certain embodiments, each of the internucleotide bonds in the ASO of the present description is a phosphorothioate bond.
[0016] [0016] The present description also provides a conjugate comprising ASO as described herein, wherein ASO is covalently linked to at least a non-nucleotide or non-polynucleotide moiety. In some embodiments, the non-nucleotide or non-polynucleotide moiety comprises a protein, a chain of fatty acids, a sugar residue, a glycoprotein, a polymer, or any combination thereof.
[0017] [0017] Also provided herein is a pharmaceutical composition comprising ASO or conjugate, as described herein, and a pharmaceutically acceptable diluent, carrier, salt or adjuvant. In certain embodiments, a pharmaceutically acceptable salt comprises a sodium salt, a potassium salt or an ammonium salt. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In some embodiments, the additional therapeutic agent is a CAMK2D antagonist. In some embodiments, the CAMK2D antagonist is an anti-CAMK2d antibody or fragment.
[0018] [0018] The present description also provides a kit comprising the ASO, the conjugate or the pharmaceutical composition, as described in this document, and instructions for use. Also described is a diagnostic kit comprising the ASO, the conjugate or the pharmaceutical composition of the present description, and instructions for use.
[0019] [0019] The present description is also a targeted method of inhibiting or reducing the expression of the CAMK2D protein in a cell, comprising administering the ASO, conjugate, or pharmaceutical composition, described in this document, to the cell expressing the CAMK2D protein, wherein the expression of the CAMK2D protein in the cell is inhibited or reduced after administration. In some aspect, the present description is directed to an in vitro method of inhibiting or reducing the expression of the CAMK2D protein in a cell, comprising contacting the ASO, the conjugate, or the pharmaceutical composition, described in this document, to the cell expressing the CAMK2D protein, in which the expression of the CAMK2D protein in the cell is inhibited or reduced after contact. In some embodiments, ASO inhibits or reduces the expression of CAMK2D transcription (for example, mRNA) in the cell after administration. In some embodiments, the expression of CAMK2D transcription (for example, mRNA) is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% after administration compared to a cell not exposed to ASO. In some embodiments, the expression of the CAMK2D protein is reduced by at least about 60%, at least about 70%, at least about
[0020] [0020] A method for reducing, ameliorating or treating one or more symptoms of a cardiovascular disease or disorder in an individual in need is provided herein, comprising administering an effective amount of ASO, conjugate or the pharmaceutical composition of the present description to the individual. The present description also provides for the use of ASO, conjugate or pharmaceutical composition, described in this document, for the manufacture of a medicament. In some embodiments, the drug is for the treatment of a cardiovascular disease or disorder in an individual in need. In some embodiments, the ASO, the conjugate or the pharmaceutical composition of the present description are for use in therapy. In some embodiments, the ASO, the conjugate or the pharmaceutical composition, described in this document, are for use in the therapy of a cardiovascular disease or disorder in an individual in need.
[0021] [0021] In some embodiments, cardiovascular disease or disorder comprises coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms , peripheral arterial disease, thromboembolic disease, venous thrombosis, or any combination thereof. In some modalities, the cardiovascular disease or disorder is heart failure. In some modalities, heart failure comprises heart failure on the left side, heart failure on the right side, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF) , heart failure with intermediate range ejection fraction (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD), or hypertrophic hypertensive cardiomyopathy.
[0022] [0022] In some modalities, the individual is a human being. In some embodiments, the ASO, conjugate or pharmaceutical composition of the present description is administered intracardiac, oral, parenteral, intrathecal, intracerebroventricular, pulmonary, topical or intraventricular. BRIEF DESCRIPTION OF THE FIGURES
[0023] [0023] FIGURES 1A and 1B show exemplary ASOs targeting the CAMK2D pre-mRNA. FIGURE 1A shows ASOs targeting a single site within the CAMK2D pre-mRNA. FIGURE 1B shows ASOs targeting multiple sites (i.e., two or three) within the CAMK2D pre-mRNA. Each column of Figures 1A and 1B shows the SEQ ID number assigned only to the ASO sequence, the target start and end positions in the CAMK2D pre-mRNA sequence (for FIGURE 1B, the various target sites are identified as # 1, # 2 or # 3), the ASO sequence without any particular chemical design or structure, the ASO number (ASO No.), and the ASO sequence with a chemical structure.
[0024] [0024] FIGURE 2 shows both the percentage reduction of CAMK2D mRNA expression in HEK293 cells (y-axis) and the relative position of ASOs in CAMK2D transcription (x-axis). Each circle represents an individual ASO. As further described in Example 2, HEK293 cells were treated with 25 µM ASO and the expression of CAMK2D mRNA (normalized to
[0025] [0025] FIGURE 3 shows certain exemplary ASOs with their design. Each column of FIGURE 3 shows SEQ ID NO for the ASO sequence only, the starting and ending target positions in the CAMK2D pre-mRNA sequence (where the ASO binds to multiple sites (see FIGURE 1B), the exemplary target start and end positions), the ASO design number (DES No.), the ASO sequence with a design, and the ASO number (ASO No.).
[0026] [0026] FIGURE 4 shows the percentage reduction in the expression of CAMK2D mRNA in both HEK293 cells and cardiomyocytes derived from human inducible pluripotent stem cells (hiPSC-CM) after in vitro culture with various ASOs, as described in Examples 2 and 3. The cells were treated with 25 µM (HEK293) or 500 nM (hiPSC-CM) ASO and the expression of CAMK2D mRNA (normalized to GAPDH) is shown as a control percentage. Where no value is provided, the specific ASO has not been tested under particular conditions.
[0027] [0027] FIGURE 5 shows the potency of the exemplary ASOs at the level of expression of CAMK2D mRNA in C57BL / 6J mice Good one week after subcutaneous administration. The expression level of CAMK2D mRNA was normalized to GAPDH and then shown in relation to the control group (ie, samples treated with saline).
[0028] [0028] It should be noted that the term "one" or "one" entity refers to one or more of that entity; for example, "a nucleotide sequence" is understood to represent one or more nucleotide sequences. As such, the terms "one" (or "one"), "one or more" and "at least one" can be used interchangeably in this document.
[0029] [0029] In addition, "and / or", when used in this document, must be taken as a specific description of each of the two aspects or components specified with or without the other. Thus, the term "and / or", as used in a sentence like "A and / or B" in this document, is intended to include "A and B", "A or B", "A" (alone) and "B "(alone). Likewise, the term “and / or”, as used in a sentence such as “A, B and / or C”, aims to cover each of the following aspects: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0030] [0030] It is understood that whenever aspects are described in this document with the language "comprising", analogous aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided.
[0031] [0031] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning as is generally understood by a person skilled in the technique to which this description relates. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide a knowledgeable person with a general dictionary with many of the terms used in that description.
[0032] [0032] Units, prefixes and symbols are indicated in the form accepted by the Système International de Unites (SI). The numerical variations are inclusive of the numbers that define the range. Unless otherwise noted, nucleotide sequences are written from left to right in the 5 'to 3' orientation. The amino acid sequences are written from left to right in the amino orientation for carboxy. The titles in this document provided are not limitations on the various aspects of the description, which can be observed with reference to the specification as a whole. Therefore, the terms defined immediately below are more fully defined with reference to the specification in its entirety.
[0033] [0033] The term “about” is used in this document to mean approximately, approximately, around, or in the regions of. When the term “about” is used in combination with a numerical range, it modifies that range by extending the limits above and below the established numerical values. In general, the term “about” can change a numerical value above and below the declared value by a variation of, for example, 10%, up or down (higher or lower). For example, if it is said that “ASO reduces the expression of the CAMK2d protein in a cell after administration of ASO by at least about 60%”, it is implied that CAMK2D levels are reduced by a range of 50% to 70% %.
[0034] [0034] The term "nucleic acids" or "nucleotides" is intended to cover multiple nucleic acids. In some embodiments, the term "nucleic acids" or "nucleotides" refers to a target sequence, for example, pre-mRNAs, mRNAs or DNAs in vivo or in vitro. When the term refers to nucleic acids or nucleotides in a target sequence, the nucleic acids or nucleotides can be sequences that occur naturally within a cell. In other embodiments, "nucleic acids" or "nucleotides" refer to a sequence in the ASOs of the description. When the term refers to a sequence in ASOs, nucleic acids or nucleotides do not occur naturally, that is, they are chemically synthesized, produced enzymatically, produced recombinantly, or any combination thereof. In one embodiment, the nucleic acids or nucleotides in ASOs are produced either synthetically or recombinantly, but they are not a naturally occurring sequence or fragment thereof. In another embodiment, the nucleic acids or nucleotides in ASOs are not occurring naturally because they contain at least one nucleotide analog that does not occur naturally. The term "nucleic acid" or "nucleoside" refers to a single segment of nucleic acid, for example, a DNA, an RNA or an analogue thereof, present in a polynucleotide. "Nucleic acid" or "nucleoside" includes naturally occurring nucleic acids or non-naturally occurring nucleic acids. In some embodiments, the terms "nucleotide", "unit" and "monomer" are used interchangeably. It will be understood that, when referring to a sequence of nucleotides or monomers, what is referred to is the sequence of bases, such as A, T, G, C or U, and their analogs.
[0035] [0035] The term "nucleotide", as used herein, refers to a glycoside comprising a sugar moiety, a base moiety and a covalently linked group (linking group), such as an internucleotide linking group of phosphate or phosphorothioate, and covers both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides containing modified sugar and / or base fractions, which are also referred to herein as “nucleotide analogs”. In this document, a single nucleotide (unit) can also be referred to as a monomer or nucleic acid unit. In certain embodiments, the term "nucleotide analogs" refers to nucleotides that have modified sugar fractions. Non-limiting examples of nucleotides that have modified sugar fractions (for example, LNA) are described elsewhere in this document. In other embodiments, the term "nucleotide analogs" refers to nucleotides that have modified nucleobase fractions. Nucleotides that have modified nucleobase fractions include, but are not limited to 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-chlorine 6-aminopurine.
[0036] [0036] The term "nucleoside", as used herein, is used to refer to a glycoside comprising a sugar portion and a base portion, and can therefore be used when referring to nucleotide units, which they are covalently linked by internucleotide bonds between ASO nucleotides. In the field of biotechnology, the term "nucleotide" is often used to refer to a monomer or nucleic acid unit. In the context of an ASO, the term "nucleotide" can refer only to the base, that is, a sequence of nucleobases comprising cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA ) and uracil (RNA), in which the presence of the main sugar chain and internucleotide bonds are implicit. Likewise, particularly in the case of oligonucleotides where one or more of the internucleotide binding groups are modified, the term "nucleotide" can refer to a "nucleoside". For example, the term "nucleotide" can be used, even when specifying the presence or nature of the bonds between the nucleosides.
[0037] [0037] The term "nucleotide length", as used herein, means the total number of nucleotides (monomers) in a given sequence. For example, the tacatattatattactcctc sequence (SEQ ID NO: 158) has 20 nucleotides; thus, the nucleotide length of the sequence is 20. The term "nucleotide length" is therefore used in this document interchangeably with "nucleotide number".
[0038] [0038] As a person skilled in the art would realize, the 5 'terminal nucleotide of an oligonucleotide does not comprise a 5' internucleotide linking group, although it may comprise a 5 'terminal group.
[0039] [0039] As used herein, the term "alkyl", alone or in combination, means a straight chain or branched chain alkyl group with 1 to 8 carbon atoms, particularly a straight chain or branched alkyl group with 1 to 6 carbon atoms and, more particularly, a straight or branched chain alkyl group having 1 to 4 carbon atoms. Examples of straight-chain and branched-chain C1-C8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, isomeric pentyls, isomeric hexyls, isomeric heptylates and isomeric octylates, particularly methyl, ethyl , propyl, butyl and pentyl. Particular examples of alkyl are methyl. Other examples of alkyl are mono, di or trifluoro methyl, ethyl or propyl, such as cyclopropyl (cPr), or mono, di or trifluoro cycloproyl.
[0040] [0040] The term "alkoxy", alone or in combination, means a group of the formula alkyl-O- in which the term "alkyl" has the meaning given above, such as methoxy, ethoxy, n-propoxy, isopropoxy, n - butoxy, isobutoxy, sec.butoxy and terc.butoxy. "Aloxy" in particular is methoxy.
[0041] [0041] The term "oxy", alone or in combination, means the group -O-.
[0042] [0042] The term "alkenyl", alone or in combination, means a straight or branched chain hydrocarbon residue comprising an olefinic bond and up to 8, preferably up to 6, particularly preferred up to 4, carbon atoms. Examples of alkenyl groups are ethylene, 1-propenyl, 2-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl and isobutenyl.
[0043] [0043] The term "alkynyl", alone or in combination, means a straight or branched chain hydrocarbon residue comprising a triple bond and up to 8, preferably up to 6, particularly preferred up to 4, carbon atoms.
[0044] [0044] The terms "halogen" or "halo", alone or in combination, mean fluorine, chlorine, bromine or iodine and, particularly, fluorine, chlorine or bromine, more particularly, fluorine and chlorine, such as fluorine. The term "halo", in combination with another group, indicates the replacement of said group by at least one halogen, particularly substituted by one to five halogens, particularly one to four halogens, that is, one, two, three or four halogens. The terms "hydroxyl" and "hydroxy", alone or in combination, mean the group - OH.
[0045] [0045] The terms "thiohydroxyl" and "thiohydroxy", alone or in combination, mean the -SH group.
[0046] [0046] The term "carbonyl", alone or in combination, means the group -C (O) -.
[0047] [0047] The term "carboxy" or "carboxyl", alone or in combination, means the -COOH group.
[0048] [0048] The term "amino", alone or in combination, means the primary amino group (-NH2), the secondary amino group (-NH-), or the tertiary amino group (-N-).
[0049] [0049] The term "alkylamino", alone or in combination, means an amino group, as defined above, replaced by one or two alkyl groups, as defined above.
[0050] [0050] The term "aminocarbonyl, alone or in combination, means the group -C (O) -NH2.
[0051] [0051] The term "sulfonyl", alone or in combination, means the -SO2 group.
[0052] [0052] The term "sulfinyl", alone or in combination, means the group -SO-.
[0053] [0053] The term "sulfanil", alone or in combination, means the group -S-.
[0054] [0054] The term "cyan", alone or in combination, means the group -CN.
[0055] [0055] The term "azido", alone or in combination, means the group -N3.
[0056] [0056] The term "nitro", alone or in combination, means the NO2 group.
[0057] [0057] The term "formyl", alone or in combination, means the group -C (O) H.
[0058] [0058] The term "aryl", alone or in combination, indicates a monovalent aromatic carbocyclic mono or bicyclic ring system comprising 6 to 10 carbon atoms in the ring, optionally substituted by 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl , alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of aryl include phenyl and naphthyl, in particular phenyl.
[0059] [0059] The term "heteroaryl", alone or in combination, indicates a monovalent aromatic heterocyclic mono- or bicyclic ring system of 5 to 12 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S , the remaining atoms in the ring being carbon, optionally substituted by 1 to 3 substituents selected independently from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of heteroaryl include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyridazinyl, pyrimidine, triazine, benzine, zinc isoindolyl, isobenzofuranyl, benzimidazolyl, benzoxazolyl, benzoyloxazolyl, benzothiazolyl, benzoisothiazolyl, benzooxadiazolyl, benzothiadiazolyl, benzotriazolyl,
[0060] [0060] The term "heterocycle", alone or in combination, indicates a monovalent non-aromatic heterocyclic mono- or bicyclic ring system of 5 to 12 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining atoms in the ring being carbon, optionally substituted by 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl and formyl.
[0061] [0061] The term "protecting group", alone or in combination, means a group that selectively blocks a reactive site in a multifunctional compound, so that a chemical reaction can be carried out selectively at another unprotected reactive site. Protection groups can be removed. Exemplary protecting groups are amino protecting groups, carboxy protecting groups or hydroxy protecting groups.
[0062] [0062] If one of the starting materials or compounds of the invention contains one or more functional groups that are not stable or are reactive under the reaction conditions of one or more reaction steps, the appropriate protecting groups (as described, for example, in “Protective Groups in Organic Chemistry” by TW Greene and PGM Wuts, 3rd Ed., 1999, Wiley, New York) can be introduced before the critical stage of application methods well known in the art. These protecting groups can be removed at a later stage of synthesis using standard methods described in the literature. Examples of protecting groups are tert-butoxycarbonyl (Boc), 9-fluorenylmethyl carbamate (Fmoc), 2-trimethylsilylethyl carbamate (Teoc), carbobenzyloxy (Cbz) and p-methoxybenzyloxycarbonyl (Moz).
[0063] The compounds described in this document may contain several asymmetric centers and may be present in the form of optically pure enantiomers, mixtures of enantiomers, such as, for example, racemates, mixtures of diastereoisomers, diastereoisomeric racemates, or mixtures of diastereoisomeric racemates.
[0064] [0064] The term "asymmetric carbon atom" means a carbon atom with four different substituents. According to the Cahn-Ingold-Prelog Convention, an asymmetric carbon atom can be of the "R" or "S" configuration.
[0065] [0065] As used herein, the term "bicyclic sugar" refers to a modified sugar portion comprising a 4- to 7-membered ring comprising a bridge connecting two 4- to 7-membered ring atoms to form a second ring , resulting in a bicyclic structure. In some embodiments, the bridge connects the C2 'and C4' of a nucleoside's ribose sugar ring (i.e., 2'-4 'bridge), as seen in the LNA nucleosides.
[0066] [0066] As used herein, a "coding region" or "coding sequence" is a portion of polynucleotide that consists of codons translatable into amino acids. Although a “stop codon” (TAG, TGA or TAA) is not typically translated into an amino acid, it can be considered part of a coding region, however, any flanking sequences, for example, promoters, ribosomal binding sites, transcriptional terminators, introns, untranslated regions ("RTUs"), and the like, are not part of a coding region. The boundaries of a coding region are typically determined by a start codon at the 5 'terminal, which encodes the amino terminal of the resulting polypeptide, and a translation stop codon at the 3' terminal, which encodes the carboxyl terminal of the resulting polypeptide.
[0067] [0067] The term "non-coding region", as used herein, means a nucleotide sequence that is not a coding region. Examples of non-coding regions include, but are not limited to, promoters, ribosomal binding sites, transcriptional terminators, introns, untranslated regions ("RTUs"), non-coding exons, and the like. Some of the exons can be wholly or part of the 5 '(5' RTU) untranslated region or the 3 '(3' RTU) untranslated region of each transcript. Untranslated regions are important for efficient transcription translation and for controlling the translation rate and transcription half-life.
[0068] [0068] The term "region", when used in the context of a nucleotide sequence, refers to a section of that sequence. For example, the phrase "region within a nucleotide sequence" or "region within the complement of a nucleotide sequence" refers to a sequence that is shorter than the nucleotide sequence, but greater than at least 10 nucleotides located in the nucleotide sequence specific or complement of the nucleotide sequence, respectively. The term “subsequence” can also refer to a region of a nucleotide sequence.
[0069] [0069] The term "downstream", when referring to a nucleotide sequence, means that a nucleic acid or nucleotide sequence is located 3 'to a reference nucleotide sequence. In certain embodiments, downstream nucleotide sequences refer to sequences that follow the starting point of transcription. For example, the codon for initiating the translation of a gene is located downstream of the initial transcription site.
[0070] [0070] The term "amount" refers to a nucleotide sequence that is located 5 'to a reference nucleotide sequence.
[0071] [0071] As used herein, the term "regulatory region" refers to nucleotide sequences located upstream (5 'non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influences the transcription, RNA processing, stability or translation of the associated coding region. Regulatory regions can include promoters, leading translation sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, RTUs and hook structures. If a coding region is to be expressed in a eukaryotic cell, a polyadenylation signal and a transcription termination sequence will generally be located 3 'to the coding sequence.
[0072] [0072] The term “transcription”, as used in this document, can refer to a primary transcription that is synthesized by DNA transcription and becomes a messenger RNA (mRNA) after processing, that is, a precursor messenger RNA ( pre-mRNA), and the processed mRNA itself. The term "transcription" can be used interchangeably with "pre-mRNA" and "mRNA". After the DNA strands are transcribed into the primary transcripts, the newly synthesized primary transcripts are modified in various ways to be converted into their mature functional forms to produce different proteins and RNAs, such as mRNA, tRNA, rRNA, lncRNA, miRNA and others. Thus, the term "transcription" can include exons, introns, 5'UTRs and 3 'UTRs.
[0073] [0073] The term "expression", as used herein, refers to a process by which a polynucleotide produces a genetic product, for example, an RNA or a polypeptide. It includes, without limitation, the transcription of the polynucleotide into messenger RNA (mRNA) and the translation of an mRNA into a polypeptide. The expression produces a "genetic product". As used herein, a genetic product can be a nucleic acid, for example, a messenger RNA produced by the transcription of a gene, or a polypeptide that is translated from a transcription. The gene products described herein further include nucleic acids with post-transcriptional modifications, for example, polyadenylation or excision, or polypeptides with post-translational modifications, for example, methylation, glycosylation, addition of lipids, association with other protein subunits , or proteolytic cleavage.
[0074] [0074] The terms "identical" or percent "identity", in the context of two or more nucleic acids, refer to two or more sequences that are the same or that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing intervals, if necessary) for maximum matching, without considering any conservative amino acid substitutions as part of the sequence identity. Percent identity can be measured using software or sequence comparison algorithms, or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.
[0075] [0075] A non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87: 2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90: 5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25: 3389- 3402). In certain embodiments, Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25: 3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266: 460-480), ALIGN, ALIGN-2 (Genentech, San Francisco do Sul, California) or Megalign (DNASTAR) are programs additional publicly available software that can be used to align strings. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (for example, using an NWSgapdna.CMP matrix and an interval weight of 40, 50, 60, 70 or 90, and a weight of length 1, 2, 3, 4, 5 or 6). In certain alternative modalities, the GAP program in the GCG software package, which incorporates the Needleman and Wunsch algorithm (J. Mol. Biol. (48): 444- 453 (1970)) can be used to determine the percentage identity between two amino acid sequences (for example, using a BLOSUM 62 matrix or a PAM250 matrix, and a weight range of 16, 14, 12, 10, 8, 6 or 4, and a length weight of 1, 2, 3, 4 , 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the Myers and Miller algorithm (CABIOS, 4: 11-17 (1989)). For example, the percentage identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residual table, a gap length penalty 12 and a gap penalty 4. One skilled in the art can determine appropriate parameters for the maximum alignment by specific alignment software. In certain embodiments, standard parameters of the alignment software are used.
[0076] [0076] In certain embodiments, the percent identity "X" of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y / Z), where Y is the number of amino acid residues marked as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the length of a first sequence is greater than that of the second sequence, the percentage identity of the first sequence to the second sequence will be greater than the percentage identity of the second sequence to the first sequence.
[0077] [0077] Different regions within a single polynucleotide target sequence that align with a polynucleotide reference sequence can have their own percent sequence identity. Note that the percentage value of the sequence identity is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13 and 80.14 are rounded to 80.1, while 80.15, 80.16, 80.17, 80.18 and 80.19 are rounded to 80, two. It is also observed that the length value will always be an integer.
[0078] [0078] As used in this document, the terms "homologue" and "homology" are interchangeable with the terms "identity" and "identical".
[0079] [0079] The term "its naturally occurring variation" refers to variants of the CAMK2D polypeptide sequence or nucleic acid sequence of CAMK2D (for example, transcription) that naturally exist within the defined taxonomic group, such as mammals, such as mice , monkeys and humans. Typically, when referring to “naturally occurring variants” of a polynucleotide, the term can also cover any allelic variant of the genomic DNA encoding CAMK2D, which is found in chromosomal Position 4q26 (that is, residues 113,451,032 to 113,761. 927 of GenBank Access No. NC_000004.12) by translocation or chromosomal duplication, and RNA, as the mRNA derived from it. "Naturally occurring variations" can also include variants derived from alternative excision of the CAMK2D mRNA. When referring to a specific polypeptide sequence, for example, the term also includes naturally occurring forms of proteins, which can therefore be processed, for example, by co- or post-translational modifications, such as cleavage of signal peptides, cleavage proteolytic, glycosylation, etc.
[0080] [0080] In determining the degree of "complementarity" between the ASOs of the description (or their regions) and the target region of the nucleic acid encoding mammalian CAMK2D (for example, the CAMK2D gene), such as those described in this document, the degree of “complementarity” (also “homology” or “identity”) is expressed as the percentage identity (or percentage of homology) between the ASOs sequence (or its region) and the target region sequence (or the region's inverse complement) target) that best aligns with it. The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, dividing by the total number of contiguous monomers in the ASO and multiplying by 100. In this comparison, if there are intervals, it is preferable that such intervals are merely incompatible, instead of areas where the number of monomers within the range differs between the description ASO and the target region.
[0081] [0081] The term "complement", as used in this document, indicates a sequence that is complementary to a reference sequence. It is known that complementarity is the basic principle of DNA replication and transcription, as it is a property shared between two DNA or RNA sequences, so that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequences will be complementary, much like looking in the mirror and seeing the reverse of things. Therefore, for example, the complement of a sequence of 5 '“ATGC” 3' can be written as 3 '“TACG” 5' or 5 '“GCAT” 3'. The terms "reverse complement", "reverse complement" and "reverse complementarity", as used in this document, are interchangeable with the terms "complement", "complement" and
[0082] [0082] The terms "corresponding to" and "corresponds to", when referring to two separate sequences of nucleic acids or nucleotides, can be used to clarify regions of the sequences that match or are similar to each other based on homology and / or functionality, although the nucleotides of the specific sequences may be numbered differently. For example, different isoforms of a gene transcription may have similar or conserved portions of nucleotide sequences whose numbering may differ in the respective isoforms based on alternative excision and / or other modifications. In addition, it is recognized that different numbering systems can be used when characterizing a sequence of nucleic acids or nucleotides (for example, a gene transcription, and whether to start numbering the sequence from the initial codon of the translation or include the 5'UTR). In addition, it is recognized that the nucleic acid or nucleotide sequence of different variants of a gene or gene transcription can vary. As used in this document, however, regions of variants that share nucleic acid or nucleotide sequence homology and / or functionality are considered to "correspond" to each other. For example, a nucleotide sequence from a CAMK2D transcript corresponding to nucleotides X to Y of SEQ ID NO: 1 ("reference sequence") refers to a CAMK2d transcription sequence (for example, pre-mRNA or mRNA CAMK2D) which has an identical or similar sequence to nucleotides X to Y of SEQ ID NO: 1, where X is the start site and Y is the end site (as shown in Figures 1A and 1B). A person skilled in the art can identify the corresponding X and Y residues in the CAMK2D transcription sequence by aligning the CAMK2D transcription sequence with SEQ ID NO: 1.
[0083] [0083] The terms "corresponding nucleotide analog" and "corresponding nucleotide" are intended to indicate that the nucleobase in the nucleotide analog and the naturally occurring nucleotide have the same matching or hybridization capacity. For example, when the 2-deoxyribose unit of the nucleotide is linked to an adenine, the "corresponding nucleotide analog" contains a pentose unit (different from 2-deoxyribose) linked to an adenine.
[0084] [0084] The term “DES number” or “No. DES ”, as used herein, refers to a single number given to a nucleotide sequence that has a specific nucleoside pattern (eg, DNA) and nucleoside analogues (eg, LNA). As used in this document, the design of an ASO is shown by a combination of uppercase and lowercase letters. For example, DES-0231 refers to an ASO tacatattatattactcctc (SEQ ID NO: 158) sequence with an ASO design LLLDDDDDDDDDDDDDDLLL (i.e., TACatattatattactcCTC), where the L (i.e., the capital letter) indicates a nucleoside analog (for example, LNA) and the D (that is, the lowercase letter) indicates a nucleoside (for example, DNA).
[0085] [0085] The ASO chemistry annotation is as follows: The nucleotides Beta-D-oxy LNA are designated by OxyB, where B designates a nucleotide base, such as thymine (T), uridine (U), cytosine (C) , 5-methylcytosine (MC), adenine (A) or guanine (G) and therefore includes OxyA, OxyT, OxyMC, OxyC and OxyG. DNA nucleotides are called DNAb, where the lowercase letter b designates a nucleotide base, such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (Mc), adenine (A) or guanine (G) and therefore includes DNAa, DNAt, DNA and DNAg. The letter M before C or c indicates 5-methylcytosine. The letter "s" indicates an internucleotide phosphorothioate bond.
[0086] [0086] The term “ASO Number” or “No. ASO ”, as used in this document, refers to a single number given to a nucleotide sequence that has the detailed chemical structure of the components, for example, nucleosides (for example, DNA), nucleoside analogues (for example, beta -D-oxy-LNA), nucleobases (for example, A, T, G, C, U or MC), and the backbone structure (for example, phosphorothioate or phosphorodiester). For example, ASO-0231 may refer to OxyTs OxyAs OxyMCs DNAas DNAts DNAas DNAts DNAts DNAas DNAts DNAas DNAts DNAts DNAas DNAcs DNAts DNAcs OxyMCs OxyTs OxyMC.
[0087] [0087] "Power" is normally expressed as an IC50 or EC50 value, in µM, nM or pM, unless otherwise indicated. The potency can also be expressed in terms of the percentage of inhibition. IC50 is the average inhibitory concentration of a therapeutic molecule. EC50 is the average effective concentration of a therapeutic molecule in relation to a vehicle or control (for example, saline). In functional assays, IC50 is the concentration of a therapeutic molecule that reduces a biological response, for example, mRNA transcription or protein expression, by 50% of the biological response that is achieved by the therapeutic molecule. In functional assays, EC50 is the concentration of a therapeutic molecule that produces 50% of the biological response, for example, mRNA transcription or protein expression. IC50 or EC50 can be calculated by any number of means known in the art.
[0088] [0088] As used herein, the term "inhibition", for example, the expression of the gene transcription of CAMK2D and / or CAMK2D protein, refers to the ASO that reduces the expression of the gene transcription of CAMK2D and / or CAMK2D protein in a cell or tissue. In some embodiments, the term "inhibition" refers to the complete inhibition (100% inhibition or undetectable level) of the gene transcription of CAMK2D or CAMK2D protein. In other embodiments, the term "inhibition" refers to at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% inhibition of gene transcription expression CAMK2D and / or the CAMK2D protein in a cell or tissue.
[0089] [0089] By "individual" or "individual" or "animal" or "patient" or "mammal" is meant any individual, particularly a mammal individual, for whom the diagnosis, prognosis or therapy is desired. Mammalian individuals include humans, domestic animals, farm animals, sport animals, and zoo animals, including, for example, humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice , horses, cattle, bears, and so on.
[0090] [0090] The term "pharmaceutical composition" refers to a preparation that allows the biological activity of the active ingredient to be effective and that does not contain additional components that are unacceptably toxic to an individual to whom the composition is administered. This composition can be sterile.
[0091] [0091] An "effective amount" of an ASO, as described in this document, is an amount sufficient to accomplish a specifically cited purpose. An "effective amount" can be determined empirically and routinely, in relation to the stated purpose.
[0092] [0092] Terms such as "treating" or "treating" or "treating" or "relieving" or "relieving" refer to both (1) therapeutic measures that cure, slow down, decrease symptoms and / or stop the progression of a pathological condition or disorder diagnosed for (2) prophylactic or preventive measures that prevent and / or delay the development of a target condition or pathological disorder. Thus, those who need treatment include those who already have the disorder; those prone to having the disorder; and those in whom the disorder must be prevented. In certain embodiments, an individual is successfully "treated" for a disease or condition, described elsewhere in this document, according to the methods provided in this document, if the patient shows, for example, total, partial or transient relief, or elimination of symptoms associated with the disease or disorder. II. Antisense oligonucleotides
[0093] [0093] The present description uses antisense oligonucleotides (ASOs) for use in modulating the function of mammalian CAMK2D nucleic acid molecules, such as the CAMK2D nucleic acid, for example, CAMK2D transcription, including CAMK2D pre-mRNA and CAMK2D mRNA, or naturally occurring variants of such nucleic acid molecules encoding mammalian CAMK2D. The term "ASO", in the context of the present description, refers to a molecule formed by covalent bonding of two or more nucleotides (i.e., an oligonucleotide).
[0094] [0094] ASO comprises a sequence of contiguous nucleotides of about 10 to about 30, such as 10-20, 14-20, 16-20 or 15-25, nucleotides in length. The terms "antisense ASO", "antisense oligonucleotide" and "oligomer", as used herein, are interchangeable with the term "ASO".
[0095] [0095] A reference to a SEQ ID number includes a particular sequence of nucleobases, but does not include any design or complete chemical structure. In addition, the ASOs described in the figures in this document show a representative design, but are not limited to the specific design shown in the Figures, unless otherwise indicated. In this document, a single nucleotide (unit) can also be referred to as a monomer or unit. When this report refers to a specific ASO number, the reference includes the sequence, the design of the specific ASO, and the chemical structure. When this report refers to a specific DES number, the reference includes the specific ASO sequence and design. For example, when a claim (or this report) refers to SEQ ID NO: 158, it includes the tacatattatattactcctc only nucleotide sequence. When a claim (or report) refers to DES-0231, it includes the nucleotide sequence of tacatattatattactcctc with the ASO design of TACatattatattactcCTC. Alternatively, the ASO-0231 design can also be written as SEQ ID NO: 158, where each of the first nucleotide, second nucleotide, third nucleotide, 18th nucleotide, the 19th nucleotide, and the 20th nucleotide of the 5 'end, is a modified nucleotide, for example, LNA, and each of the other nucleotides is an unmodified nucleotide (for example, DNA). The ASO number includes the sequence and design of the ASO, as well as the specific details of the ASO. Therefore, for example, ASO-0231, referred to in this application, indicates OxyTs OxyAs OxyMCs DNAas DNAts DNAas DNAts DNAts DNAas DNAas DNAts DNAts
[0096] [0096] In several modalities, the description ASO does not comprise RNA (units). In some embodiments, the ASO comprises one or more units of DNA. In one embodiment, the ASO according to the description is either a linear molecule or is synthesized as a linear molecule. In some embodiments, the ASO is a single-stranded molecule and does not comprise short regions of, for example, at least 3, 4 or 5 contiguous nucleotides, which are complementary to equivalent regions within the same ASO (ie, duplexes) - in that aspect, the ASO is not (essentially) double-stranded. In some embodiments, ASO is not essentially double-stranded. In some modalities, ASO is not a siRNA. In various embodiments, the ASO of the description may consist entirely of the contiguous nucleotide region. Thus, in some modalities, ASO is not substantially self-complementary.
[0097] [0097] In other embodiments, the present description includes fragments of ASOs. For example, the description includes at least one nucleotide, at least two contiguous nucleotides, at least three contiguous nucleotides, at least four contiguous nucleotides, at least five contiguous nucleotides, at least six contiguous nucleotides, at least seven contiguous nucleotides, at least eight contiguous nucleotides, or at least nine contiguous nucleotides from the ASOs described herein. Fragments of any of the sequences described in this document are considered to be part of the description. II.A. The target
[0098] [0098] Suitably, the ASO of the description is able to down-regulate (for example, reduce or remove) the expression of the CAMK2D mRNA or protein. In that regard, the ASO of the description can affect indirect inhibition of the CAMK2D protein by reducing the levels of CAMK2D mRNA, typically in a mammalian cell, such as a human cell, such as a cardiocyte. In particular, the present description is directed to ASOs that target one or more regions of the CAMK2D pre-mRNA (for example, intron regions, exon regions and / or exon-intron junction regions). Unless otherwise indicated, the term “CAMK2D”, as used in this document, can refer to CAMK2D of one or more species (for example, humans, non-human primates, dogs, cats, guinea pigs, rabbits , rats, mice, horses, cattle and bears).
[0099] [0099] Calcium-dependent protein kinase / calmodulin delta type II (CAMK2D) is also known as the delta subunit of CaM kinase II and the delta subunit of CamK-II. CAMK2D synonyms are known and include CaMKIIδ or CAMKD. The sequence for the human CAMK2D gene can be found under the publicly available GenBank Accession Number NC_000004.12. The sequence for human CAMK2D pre-mRNA transcription (SEQ ID NO: 1) corresponds to the reverse complement of residues 113,451,032 -
[0100] [0100] Natural variants of the human CAMK2D gene product are known. For example, natural variants of the human CAMK2D protein may contain one or more amino acid substitutions selected from: D167E, Q463E and T493I, and any combinations thereof. Additional variants of the human CAMK2D protein resulting from alternative excision are also known in the art. The CAMK2D Delta 3 Isoform (identifier: UniProt Q13557-3) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K → KKRKSSSSVQMM. The sequence of the CAMK2D Delta 4 isoform (identifier: Q13557-4) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K → KINNKANVVTSPKENIPTPAL. The sequence of the CAMK2D Isoform Delta 6 (identifier: Q13557-8) differs from the canonical sequence (SEQ ID NO: 3) as follows: 479-499: Absent. The sequence of the Isoform Delta 7 of CAMK2D (identifier: Q13557-9) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K → KKRKSSSSVQMM and 479-499: Absent. The sequence of the Isoform Delta 8 of CAMK2D (identifier: Q13557-5) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K → KINNKANVVTSPKENIPTPAL and 479-499: Absent. The sequence of the Delta 9 isoform of CAMK2D (identifier: Q13557-6) differs from the canonical sequence (SEQ ID NO: 3) as follows: 329-329: E → EPQTTVIHNPDGNKE. The sequence of the CAMK2D Isoform Delta 10 (identifier: Q13557-10) differs from the canonical sequence (SEQ ID NO: 3) as follows: 329-329: E → EPQTTVIHNPDGNKE and 479-499: Absent. The sequence of the CAMK2D Delta 11 Isoform (identifier: Q13557-11) differs from the canonical sequence (SEQ ID NO: 3) as follows: 328-328: K → KKRKSSSSVQMMEPQTTVIHNPDGNK. The sequence of the CAMK2D Isoform Delta 12 (identifier: Q13557-12) differs from the canonical sequence (SEQ ID NO: 3) as follows: 478-478: K → N and 479-499: Absent. Therefore, the ASOs of the present description can be designed to reduce or inhibit the expression of the natural variants of the CAMK2D protein.
[0101] [0101] An example of a target nucleic acid sequence for
[0102] [0102] In some embodiments, an ASO of the description hybridizes to a region within the introns of a CAMK2D transcript, for example, SEQ ID NO: 1. In certain embodiments, an ASO of the description hybridizes to a region within the exons of a CAMK2D transcription, for example, SEQ ID NO: 1. In other modalities, a
[0103] [0103] In some embodiments, ASO targets an mRNA that encodes a particular isoform of the CAMK2D protein (eg Isoform Delta 3-12). In some modalities, ASO targets all isoforms of the CAMK2D protein. In other modalities, ASO targets two isoforms (for example, Isoform Delta 3 and Isoform Delta 7, Isoform Delta 4 and Isoform Delta 8, and Isoform Delta 9 and Isoform Delta 10) of the CAMK2D protein.
[0104] [0104] In some embodiments, the ASO comprises a contiguous nucleotide sequence (for example, 10 to 30 nucleotides in length) that is complementary to a nucleic acid sequence within a CAMK2D transcript, for example, a region corresponding to SEQ ID NO: 1. In some embodiments, the ASO comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a CAMK2D transcription ("target region"), in which the sequence of nucleic acids correspond to nucleotides: (i) nucleotides 625 - 842 of SEQ ID NO: 1; (ii) 1,398 - 59,755 nucleotides of SEQ ID NO: 1; (iii) nucleotides 61,817 - 104,725 of SEQ ID NO: 1; (iv) nucleotides 112,162 - 118,021 of SEQ ID NO: 1; (v) nucleotides 119,440 - 135,219 of SEQ ID NO: 1; (vi) nucleotides 137,587 - 157,856 of SEQ ID NO: 1; (vii) nucleotides
[0105] [0105] In some embodiments, the target region corresponds to nucleotides 725 - 742 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 1,498 - 59,655 of SEQ ID NO: 1. In certain embodiments, the target region corresponds to nucleotides 61,917 - 104,625 of SEQ ID NO: 1. In some embodiments, the target region corresponds to nucleotides 112,262 -
[0106] [0106] In some embodiments, the target region corresponds to nucleotides 725 - 742 of SEQ ID NO: 1 ± 10, ± 20, ± 30, ± 40, ± 50, ± 60, ± 70, ± 80 or ± 90 nucleotides in 3 'end and / or 5' end. In other embodiments, the target region corresponds to nucleotides 1,498 - 59,655 of SEQ ID NO: 1 ± 10, ± 20, ± 30, ± 40, ± 50, ± 60, ± 70, ± 80, or ± 90 nucleotides at end 3 'and / or the 5' end. In certain embodiments, the target region corresponds to nucleotides 61,917 - 104,625 of SEQ ID NO: 1 ± 10, ± 20, ± 30, ± 40, ± 50, ± 60, ± 70, ± 80, or ± 90 nucleotides at end 3 'and / or the 5' end. In some embodiments, the target region corresponds to nucleotides 112,262 - 117,921 of SEQ ID NO: 1 ± 10, ± 20, ± 30, ± 40, ± 50, ± 60, ± 70, ± 80, or ± 90 nucleotides at end 3 'and / or the 5' end. In some embodiments, the target region corresponds to nucleotides 119,540 - 135,119 of SEQ ID NO: 1 ± 10, ± 20, ± 30,
[0107] [0107] In some embodiments, the ASO of the present description hybridizes to several target regions within the CAMK2D transcript (for example, pre-mRNA, SEQ ID NO: 1). In some embodiments, ASO hybridizes to two different target regions within the CAMK2D transcript. In some embodiments, ASO hybridizes to three different target regions within the CAMK2D transcript. The exemplary ASO sequences that hybridize to various target regions and the start / end sites of the different target regions are provided in FIGURE 1B. In some embodiments, ASOs that hybridize to various regions within the CAMK2D transcription (eg, pre-mRNA, SEQ ID NO: 1) are more potent (eg, with lower EC50) in reducing CAMK2D expression compared to ASOs that hybridize to a single region within the CAMK2D transcript (for example, pre-mRNA, SEQ ID NO: 1).
[0108] [0108] In some embodiments, the ASO of the description is able to hybridize to the target nucleic acid (e.g., CAMK2D transcription) under physiological conditions, i.e., in vivo conditions. In some embodiments, the ASO of the description is able to hybridize to the target nucleic acid (e.g., CAMK2D transcription) in vitro. In some embodiments, the ASO of the description is able to hybridize to the target nucleic acid (e.g., CAMK2D transcription) in vitro under stringent conditions. Strict conditions for in vitro hybridization depend, among other things, on productive cell uptake, RNA accessibility, temperature, free association energy, salt concentration, and time (see, for example, Stanley T Crooke, Antisense Drug Technology : Principles, Strategies and Applications, 2nd Edition, CRC Press (2007)). Generally, high to moderate stringency conditions are used for in vitro hybridization to allow hybridization between substantially similar nucleic acids, but not between different nucleic acids. An example of stringent hybridization conditions includes hybridization in 5X sodium saline-citrate (SSC) buffer (0.75 M sodium chloride / 0.075 M sodium citrate) for 1 hour at 40 ° C, followed by sample washing 10 times in 1X SSC at 40 ° C and 5 times in 1X SSC buffer at room temperature. In vivo hybridization conditions consist of intracellular conditions (for example, physiological pH and intracellular ionic conditions) that direct the hybridization of antisense oligonucleotides to target sequences. In vivo conditions can be imitated in vitro by relatively low stringent conditions. For example, hybridization can be performed in vitro on 2X SSC (0.3 M sodium chloride / 0.03 M sodium citrate), 0.1% SDS at 37 ° C. A washing solution containing 4X SSC, 0.1% SDS can be used at 37 ° C, with a final wash in 1X SSC at 45 ° C.
[0109] [0109] In some embodiments, the ASO of the present description is able to target a transcription of CAMK2D of one or more species (for example, humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle and bears). In certain embodiments, the ASO described in this document is capable of directing the transcription of CAMK2D in both humans and rodents (for example, mice or rats). Therefore, in some embodiments, ASO is able to down-regulate (for example, reduce or remove) the expression of mRNA or CAMK2D protein in both humans and rodents (for example, mice or rats).
[0110] [0110] Mouse CAMK2D transcription sequences are known in the art. For example, the mouse CAMK2D gene sequence can be found under the publicly available GenBank Accession Number NC_000069.6. The sequence for the mouse CAMK2D pre-mRNA transcription corresponds to residues 126,596,354 - 126,846,326 of NC_000069.6. The sequences for the transcription of mouse CAMK2D mRNA (both canonical and variants) are known and are available in Accession Numbers NM_001025438.2 (canonical sequence), NM_001025439.2, NM_001293663.1, NM_001293664.1, NM_023813.4 , NM_001346635.1, NM_001346636.1, NM_001293665.1, XM_006500836.3, XM_006500833.3, XM_006500835.3, XM_017319415.1, XM_006500818.3, XM_017319417.1, XM_0173, XM_0173, XM_0173, .3, XM_017319416.1, XM_006500820.3, XM_006500822.3, XM_006500823.3, XM_006500824.3, XM_017319419.1, XM_006500826.3, XM_006500825.3, XM_006500829.3, BC05 , XM_017319422.1, XM_006500834.3, XM_006500839.3, and XM_017319421.1. The sequence of the mouse CAMK2D protein can be found in the publicly available Access Numbers: Q6PHZ2 (canonical sequence), Q3UF87, Q3UQH9, Q5DTK4, Q8CAC5 and Q9CZE2, each being incorporated into this document by reference in its entirety. Three isoforms of the mouse CAMK2D protein are known. The sequence of the CAMK2D Delta 6 Isoform differs from the canonical sequence as follows: 478-478: K → N and 479-499: Absent. The sequence of the CAMK2D Delta 10 Isoform differs from the canonical as follows: 329-329: E → EPQTTVIHNPDGNKE; 478-478: K → N; and 479-499: Absent. The sequence of the Isoform Delta 5 of CAMK2D differs from the canonical sequence as follows: 328-328: K → KINNKANVVTSPKENIPTPALEPQTTVIHNPDGNK; 478-478: K → N and 479-499: Absent.
[0111] [0111] Transcriptional sequences of rat CAMK2D are also known in the art. The mouse CAMK2D gene can be found under the publicly available GenBank Accession Number NC_005101.4. The sequence for the rat CAMK2D pre-mRNA transcription corresponds to residues 230.900.907 -
[0112] [0112] The ASOs of the description comprise a contiguous nucleotide sequence that corresponds to the complement of a CAMK2D transcription region, for example, a nucleotide sequence corresponding to SEQ ID NO: 1.
[0113] [0113] In certain embodiments, the description provides an ASO of 10 to 30, such as 10 to 15 nucleotides, 10 to 20 nucleotides or 10 to 25 nucleotides in length, where the contiguous nucleotide sequence is at least about 80% at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity of a region within the complement of a CAMK2D transcript, such as SEQ ID NO: 1 or its naturally occurring variant. Thus, for example, the ASO hybridizes to a single stranded nucleic acid molecule having the sequence of SEQ ID NO: 1 or a portion thereof.
[0114] [0114] The ASO may comprise a contiguous nucleotide sequence that is completely complementary (perfectly complementary) to the equivalent region of a nucleic acid encoding a mammalian CAMK2D protein (for example, SEQ ID NO: 1). The ASO can comprise a sequence of contiguous nucleotides that is completely complementary (perfectly complementary) to a nucleic acid sequence, or a region within the sequence, corresponding to the XY nucleotides of SEQ ID NO: 1, where X and Y are the site initial and final site, respectively, as shown in Figures 1A and 1B.
[0115] [0115] In some embodiments, the ASO nucleotide sequence of the description or the contiguous nucleotide sequence has at least about 80% sequence identity with a selected sequence from SEQ ID NOs: 4 to 1713 (that is, the sequences in Figures 1A and 1B), such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, such as about 100% sequence identity (homologous). In some embodiments, the ASO has a design described elsewhere in this document (for example, Section II.G) or a chemical structure shown elsewhere in this document (for example, Figures 1A and 1B).
[0116] [0116] In some embodiments, the ASO (or its contiguous nucleotide portion) is selected from, or comprises, one of the sequences selected from the group consisting of SEQ ID NOs: 4 to 1713 or a region of at least 10 of its contiguous nucleotides, wherein the ASO (or its contiguous nucleotide moiety) may optionally comprise one, two, three or four incompatibilities when compared to the corresponding CAMK2D transcript.
[0117] [0117] In some embodiments, the ASO comprises a sequence selected from the group consisting of SEQ ID NO: 254, SEQ ID NO: 27, SEQ ID NO: 114, SEQ ID NO: 158, SEQ ID NO: 190, SEQ ID NO: 327, SEQ ID NO: 463, SEQ ID NO: 513, SEQ ID NO: 516, SEQ ID NO: 519, SEQ ID NO: 657, SEQ ID NO: 659, SEQ ID NO: 827, SEQ ID NO: 1249, SEQ ID NO: 1326, SEQ ID NO: 1409, SEQ ID NO: 1524, SEQ ID NO: 1530, SEQ ID NO: 1662 and SEQ ID NO: 1676.
[0118] [0118] In some embodiments, the ASO comprises a sequence selected from the group consisting of SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 92, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 133, SEQ ID NO: 138, SEQ ID NO: 161, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 186, SEQ ID NO: 195, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 234, SEQ ID NO: 264, SEQ ID NO: 387, SEQ ID NO: 390, SEQ ID NO: 396, SEQ ID NO: 441, SEQ ID NO: 446, SEQ ID NO: 457, SEQ ID NO: 467, SEQ ID NO: 523, SEQ ID NO: 524, SEQ ID NO: 636, SEQ ID NO: 640, SEQ ID NO: 700, SEQ ID NO: 740, SEQ ID NO: 832, SEQ ID NO: 965, SEQ ID NO: 1015, SEQ ID NO: 1065, SEQ ID NO: 1071, SEQ ID NO: 1155, SEQ ID NO: 1475, SEQ ID NO: 1508, SEQ ID NO: 1685, SEQ ID NO: 1686, SEQ ID NO: 1687, SEQ ID NO: 1688, and SEQ ID NO: 1690.
[0119] [0119] In some embodiments, the ASOs of the description bind to the target nucleic acid sequence (eg, CAMK2D transcription) and are capable of inhibiting or reducing the expression of the CAMK2D transcript by at least 10% or 20% in comparison with the level of normal expression in the cell (ie control), for example, at least about 30%, at least about 40%, at least about
[0120] [0120] In some embodiments, the ASOs of the description are able to reduce the expression of CAMK2D mRNA in vitro by at least about 20%, at least about 30%, at least about 40%, at least about 50 %, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97% , at least about 98%, at least about 99%, or about 100% in HEK293 cells when cells are in contact with 25 µM of ASO compared to HEK293 cells that are not in contact with ASO (for example , contact with saline).
[0121] [0121] In some embodiments, the ASOs of the description are able to reduce the expression of CAMK2D mRNA in vitro by at least about 20%, at least about 30%, at least about 40%, at least about 50 %, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97% at least about 98%, at least about 99%, or about 100% in cardiomyocyte cells derived from human inducible pluripotent stem cells (hiPSC-CM) when the cells are in contact with 500 nM of the ASO in comparison with hiPSC-CM cells that are not in contact with ASO (for example, contact with saline).
[0122] [0122] In certain embodiments, the description's ASO has at least one property selected from the group consisting of: (i) reducing a level of mRNA encoding CAMK2D in Inducible Pluripotent Stem Cell-derived Cardiomyocytes (hiPSC-CM); (ii) reducing the level of CAMK2D protein in hiPSC-CM; (iii) reduce, improve or treat one or more symptoms of a cardiovascular disease or disorder, and (iv) any combinations thereof.
[0123] [0123] In some modalities, the ASO can tolerate 1, 2, 3 or 4 (or more) incompatibilities, by hybridizing with the target sequence and still bind sufficiently to the target to show the desired effect, that is, negative regulation of mRNA and / or target protein. Incompatibilities can, for example, be compensated for by increasing the length of the ASO nucleotide sequence and / or an increased number of nucleotide analogs, which are described elsewhere in this document.
[0124] [0124] In some embodiments, the ASO of the description comprises no more than 3 incompatibilities when hybridizing to the target sequence. In other embodiments, the contiguous nucleotide sequence comprises no more than 2 incompatibilities when hybridizing to the target sequence. In other embodiments, the contiguous nucleotide sequence comprises no more than 1 incompatibility when hybridizing to the target sequence. II.C. ASO length
[0125] [0125] ASOs can comprise a sequence of contiguous nucleotides out of a total of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides in length. It should be understood that when an interval is given to an ASO, or length of contiguous nucleotide sequence, the interval includes the lower and upper lengths provided in the interval, for example (or between) 10-30, includes both 10 and 30 .
[0126] [0126] In some embodiments, ASOs comprise a sequence of contiguous nucleotides out of a total of about 14-20, 14,
[0127] [0127] In one aspect of the description, ASOs comprise one or more nucleoside analogs that occur non-naturally. “Nucleoside analogs”, as used herein, are variants of natural nucleosides, such as DNA or RNA nucleosides, due to modifications in the sugar and / or base fractions. Analogues can, in principle, be merely "silent" or "equivalent" to natural nucleosides in the context of the oligonucleotide, that is, have no functional effect on the way the oligonucleotide works to inhibit the expression of the target gene. Such "equivalent" analogs can, however, be useful if, for example, they are easier or cheaper to manufacture, or are more stable for storage or manufacturing conditions, or represent an identification or label. In some embodiments, however, analogs will have a functional effect on the way ASO works to inhibit expression; for example, producing increased binding affinity to the target, and / or increased resistance to intracellular nucleases, and / or greater ease of transport to the cell. Specific examples of nucleoside analogs are described, for example, by Freier &Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 293-213, and in Scheme 1. The ASOs of this description may contain more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine, more than 10, more than 11, more than 12, more than 13, more than 14, more than 15, more than 16, more than 18, more than 19, or more than 20 nucleoside analogs. In some embodiments, the nucleoside analogues in ASOs are the same. In other embodiments, the nucleoside analogues in ASOs are different. The nucleotide analogs in ASOs can be any or a combination of the following nucleoside analogs. II.D.1. Nucleobase
[0128] [0128] The term nucleobase includes the portions of purine (eg, adenine and guanine) and pyrimidine (eg, uracil, thymine and cytosine) present in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present description, the term nucleobase also encompasses modified nucleobases that may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In some embodiments, the nucleobase portion is modified by modifying or replacing the nucleobase. In this context, “nucleobase” refers to both naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are, for example, described in Hirao et al., (2012) Accounts of Chemical Research vol 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl 37 1.4.1.
[0129] [0129] In some embodiments, the nucleobase portion is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a selected isocytosine, pseudoisocytosine, 5-methyl cytosine nucleobase, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2- aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.
[0130] [0130] Nucleobase fractions can be indicated by the letter code for each corresponding nucleobase, for example, A, T, G, C or U, where each letter can optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase fractions are selected from A, T, G,
[0131] [0131] The ASO of the description may comprise one or more nucleosides that have a modified sugar moiety, i.e., a modification of the sugar moiety compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleosides with modification of the ribose sugar portion have been produced, mainly with the aim of improving certain properties of oligonucleotides, such as affinity and / or resistance to nuclease.
[0132] [0132] Such modifications include those in which the structure of the ribose ring is modified, for example, by substitution with a hexose ring (HNA), or a bicyclic ring, which normally has a biradical bridge between C2 'and C4' carbons in the ribose ring (LNA), or an unbound ribose ring, which normally does not have a bond between the C2 'and C3' carbons (for example, UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). The modified nucleosides also include nucleosides in which the sugar portion is replaced by a non-sugar portion, for example, in the case of peptide nucleic acids (PNA), or morpholinic nucleic acids.
[0133] [0133] Sugar modifications also include modifications made by changing the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in RNA nucleosides. Substituents can, for example, be introduced in positions 2 ', 3', 4 'or 5'. The nucleosides with modified sugar fractions also include 2 'modified nucleosides, such as 2' substituted nucleosides. In fact, much focus has been used in the development of 2 'substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as increased resistance and affinity to nucleosides. II.D.2.a Modified 2 'Nucleosides
[0134] [0134] A 2 'sugar modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position (2 'substituted nucleoside) or that comprises a 2' linked birradical, and includes nucleosides substituted in 2 'and LNA nucleosides (in 2' - 4 'birradical bridge). For example, 2 'modified sugar can provide increased binding affinity (e.g., 2' sugar modified nucleoside that increases affinity), and / or increased nuclease resistance for the oligonucleotide. Examples of modified 2 'nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino -DNA, 2'-Fluoro-RNA, 2'-Fluro-DNA, arabic nucleic acids (ANA), and 2'-Fluoro-ANA nucleoside. For more examples, please see, for example, Freier &Altmann; Nucl. Acid Res., 1997, 25, 4429-4443; Uhlmann, Curr. Opinion in Drug Development, 2000, 3 (2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some modified 2 'nucleosides.
[0135] [0135] LNA nucleosides are 2 'sugar-modified nucleosides that comprise a linker group (referred to as a birradical or a bridge) between C2' and C4 'of a nucleoside's ribose sugar ring (i.e., 2'-4 bridge '), which restricts or blocks the conformation of the ribose ring. These nucleosides are also called bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. Blocking the ribose conformation is associated with an increased affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide by a complementary RNA or DNA molecule. This can usually be determined by measuring the melting temperature of the oligonucleotide / duplex complement.
[0136] [0136] Exemplary non-limiting LNA nucleosides are described in WO 99/014226, WO 00/66604, WO 98/039352, WO 2004/046160, WO 00/047599, WO 2007/134181, WO 2010/077578, WO 2010/036698 , WO 2007/090071, WO 2009/006478, WO 2011/156202, WO 2008/154401, WO 2009/067647, WO 2008/150729, Morita et al., Bioorganic & Med.Chem. Lett. 12, 73-76, Seth et al., J. Org. Chem. 2010, Vol 75 (5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37 (4), 1225-1238.
[0137] [0137] The 2'-4 'bridge comprises 1 to 4 bridged atoms and is, in particular, of the formula -X-Y- in which
[0138] [0138] X is oxygen, sulfur, -CRaRb-, -C (Ra) = C (Rb), -C (= CRaRb) -, - C (Ra) = N, -Si (Ra) 2-, -SO2 -, -NRa-; -O-NRa-, -NRa-O-,> C = J, Se; –CPr-, - O-NRa-, NRa-CRaRb-, -N (Ra) -O-, or -O-CRaRb-;
[0139] [0139] Y is oxygen, sulfur, - (CRaRb) n -, -CRaRb-O-CRaRb-, - C (Ra) = C (Rb), -C (Ra) = N, -Si (Ra) 2- , -SO2-, -NRa-, or> C = J Se; –CPr-, -O- NRa -, - O-CRaRb-, or NRa-CRaRb-; where n is 1 or 2;
[0140] [0140] with the proviso that -XY- is not -OO-, Si (Ra) 2-Si (Ra) 2-, - SO2-SO2-, -C (Ra) = C (Rb) -C (Ra ) = C (Rb), -C (Ra) = NC (Ra) = N-, -C (Ra) = N- C (Ra) = C (Rb), -C (Ra) = C (Rb) - C (Ra) = N-, or -Se-Se-;
[0141] [0141] J is oxygen, sulfur, CH2, or = N (Ra);
[0142] [0142] Ra and Rb are independently selected from hydrogen, halogen, hydroxyl, cyano, thiohydroxyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocycle, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, carbamido, alkanoyloxy, alkylsulfonyloxy sulfone, nitro, azido, heterosulfidealkyloxy, aryloxycarbonyl, aryloxycarbonyl, aryloxycarbonyl ) Rc, -OC (= Xa) NRcRd and - NReC (= Xa) NRcRd; or two twin Ra and Rb together form optionally substituted methylene; wherein substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene are alkyl, alkenyl, alkynyl and methylene substituted by 1 to 3 substituents independently selected from halogen, hydroxyl, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl , alkoxycarbonyl, alkylcarbonyl, formyl, heterocycle, aryl and heteroaryl;
[0143] [0143] Xa is oxygen, sulfur or -NRc;
[0144] [0144] Rc, Rd and Re are, independently, hydrogen or alkyl; and
[0145] [0145] n is 1, 2 or 3.
[0146] [0146] In some embodiments, X is oxygen, sulfur, -NRa-, - CRaRb- or -C (= CRaRb) -, particularly oxygen, sulfur, -NH-, -CH2- or -C (= CH2) -, more particularly, oxygen.
[0147] [0147] In some embodiments, Y is -CRaRb-, -CRaRb-CRaRb- or - CRaRb-CRaRb-CRaRb-, particularly -CH2-CHCH3-, -CHCH3-CH2-, CH2-CH2- or -CH2-CH2- CH2-.
[0148] [0148] In some embodiments, -XY- is -O- (CRaRb) n-, -S-CRaRb-, -N (Ra) CRaRb-, -CRaRb-CRaRb-, -O-CRaRb-O-CRaRb-, -CRaRb-O-CRaRb-, -C (= CRaRb) -CRaRb-, -N (Ra) CRaRb-, -ON (Ra) CRaRb-, or -N (Ra) -O- CRaRb-.
[0149] [0149] In some embodiments, Ra and Rb are independently selected from the group consisting of hydrogen, halogen, hydroxyl, alkyl and alkoxyalkyl, in particular, hydrogen, alkyl and alkoxyalkyl.
[0150] [0150] In some embodiments, Ra and Rb are independently selected from the group consisting of hydrogen, halogen, such as fluorine, hydroxyl, methyl and -CH2-O-CH3, in particular, hydrogen, methyl and -CH2-O-CH3 .
[0151] [0151] In some embodiments, Ra is hydrogen or alkyl, in particular, hydrogen or methyl.
[0152] [0152] In some embodiments, Rb is hydrogen or alkyl, in particular hydrogen or methyl. In some embodiments, one or both Ra and Rb are hydrogen. In certain embodiments, only one of Ra and Rb is hydrogen. In some embodiments, one of Ra and Rb is methyl and the other is hydrogen. In other modalities, Ra and Rb are both methyl at the same time.
[0153] [0153] In a particular embodiment of the invention, -XY- is -O-CH2-, - S-CH2-, -S-CH (CH3) -, -NH-CH2-, -O-CH2CH2-, -O- CH (CH2-O-CH3) -, -O- CH (CH2CH3) -, -O-CH (CH3) -, -O-CH2-O-CH2-, -O-CH2-O-CH2-, -CH2 -O- CH2-, -C (= CH2) CH2-, -C (= CH2) CH (CH3) -, -N (-O-CH3) - or -N (CH3) -;
[0154] [0154] In some embodiments, -X-Y- is -O-CRaRb- where Ra and Rb are independently selected from the group consisting of hydrogen, alkyl and alkoxyalkyl, in particular hydrogen, methyl and - CH2-O-CH3.
[0155] [0155] In some embodiments, -X-Y- is -O-CH2- or -O-CH (CH3), particularly -O-CH2-.
[0156] [0156] The bridge 2'- 4 'can be positioned below the plane of the ribose ring (beta-D- configuration), or above the ring plane (alpha-L- configuration), as shown in formula (A) and formula (B), respectively.
[0157] [0157] In some embodiments, the modified nucleoside or ASN LNA nucleosides of the description has a general structure of formula II or III: Formula II Formula III
[0158] [0158] where
[0159] [0159] W is selected from -O-, -S-, -N (Ra) -, -C (RaRb) -, in particular -O-;
[0160] [0160] B is a nucleobase or a modified nucleobase portion;
[0161] [0161] Z is an internucleoside bond to an adjacent nucleoside or a 5 'terminal group;
[0162] [0162] Z * is an internucleoside bond to an adjacent nucleoside or a 3 'terminal group;
[0163] [0163] R1, R2, R3, R5 and R5 * are independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, azide, heterocycle and aryl;
[0164] [0164] In some embodiments, –X-Y-, Ra is hydrogen or alkyl, in particular hydrogen or methyl. In some embodiments of -X-Y-, Rb is hydrogen or alkyl, in particular hydrogen or methyl. In other modalities of –X-Y-, one or both of Ra and Rb are hydrogen. In other modalities of –X-Y-, only one of Ra and Rb is hydrogen. In some modalities of –X-Y-, one of Ra and Rb is methyl and the other is hydrogen. In certain modalities of –X-Y-, Ra and Rb are both methyl at the same time.
[0165] [0165] In some embodiments, –X-, Ra is hydrogen or alkyl, in particular hydrogen or methyl. In some modalities of –X-, R b is hydrogen or alkyl, in particular hydrogen or methyl. In other modalities of –X-, one or both Ra and Rb are hydrogen. In certain modalities of –X-, only one of Ra and Rb is hydrogen. In certain modalities of –X-, one of Ra and Rb is methyl and the other is hydrogen. In other modalities of –X-, Ra and Rb are both methyl at the same time.
[0166] [0166] In some embodiments, –Y-, Ra is hydrogen or alkyl, in particular hydrogen or methyl. In certain embodiments of -Y-, Rb is hydrogen or alkyl, in particular hydrogen or methyl. In other modalities of –Y-, one or both of Ra and Rb are hydrogen. In some modalities of –Y-, only one of Ra and Rb is hydrogen. In other modalities of –Y-, one of Ra and Rb is methyl and the other is hydrogen. In some modalities of –Y-, Ra and Rb are both methyl at the same time.
[0167] [0167] In some embodiments, R1, R2, R3, R5 and R5 * are independently selected from hydrogen and alkyl, in particular hydrogen and methyl.
[0168] [0168] In some modalities, R1, R2, R3, R5 and R5 * are all hydrogens at the same time.
[0169] [0169] In some embodiments, R1, R2, R3 are all hydrogens at the same time, one of R5 and R5 * is hydrogen and the other is as defined above, in particular alkyl, more particularly methyl.
[0170] [0170] In some modalities, R1, R2, R3 are all hydrogens at the same time, one from R5 and R5 * is hydrogen and the other is azide.
[0171] [0171] In some modalities, -X-Y- is -O-CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such LNA nucleosides are described in WO 99/014226, WO 00/66604, WO 98/039352 and WO 2004/046160, all of which are incorporated herein by reference, and include what is commonly known in the art as beta-D- nucleosides. oxide LNA and alpha-L-oxide LNA.
[0172] [0172] In some modalities, -X-Y- is -S-CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such LNA nucleosides are described in WO 99/014226 and WO 2004/046160, which are incorporated herein by reference.
[0173] [0173] In some modalities, -X-Y- is -NH-CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such amino LNA nucleosides are described in WO 99/014226 and WO 2004/046160, which are incorporated herein by reference.
[0174] [0174] In some embodiments, -X-Y- is -O-CH2CH2- or - OCH2CH2CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such LNA nucleosides are described in WO 00/047599 and Morita et al., Bioorganic & Med.Chem. Lett. 12, 73-76, which are incorporated herein by reference, and include what is commonly known in the art as 2'-O, 4'-C-ethylene (ENA) bridged nucleic acids.
[0175] [0175] In some modalities, -XY- is -O-CH2-, W is oxygen, R1, R2, R3 are all hydrogen at the same time, one of R5 and R5 * is hydrogen and the other is not hydrogen, as alkyl, for example methyl. Such 5 'substituted LNA nucleosides are described in WO 2007/134181, which is incorporated herein by reference.
[0176] [0176] In some embodiments, -XY- is -O-CRaRb-, where one or both of Ra and Rb are not hydrogen, in particular alkyl, such as methyl, W is oxygen, R1, R2, R3 are all hydrogen at the same time,
[0177] [0177] In some embodiments, -XY- is -O-CH (CH2-O-CH3) - (“2 'O-methoxyethyl bicyclic nucleic acid”, Seth et al., J. Org. Chem. 2010, Vol 75 (5) pp. 1569-81).
[0178] [0178] In some modalities, -X-Y- is -O-CHRa-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such 6 'substituted LNA nucleosides are described in WO 2010/036698 and WO 2007/090071, both of which are incorporated herein by reference. In such 6 'substituted LNA nucleosides, Ra is, in particular, C1-C6 alkyl, such as methyl.
[0179] [0179] In some embodiments, -X-Y- is -O-CH (CH2-O-CH3) -, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such LNA nucleosides are also known in the art as cyclic MOEs (cMOE) and are described in WO 2007/090071.
[0180] [0180] In some modalities, -X-Y- is -O-CH (CH3) -.
[0181] [0181] In some embodiments, -X-Y- is -O-CH2-O-CH2- (Seth et al., J. Org. Chem 2010 op. Cit.)
[0182] [0182] In some embodiments, -X-Y- is -O-CH (CH3) -, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such 6'-methyl LNA nucleosides are also known in the art as cET nucleosides and can be diastereoisomers (S) -cET or (R) - cET, as described in WO 2007/090071 (beta-D) and WO 2010/036698 (alpha -L), which are incorporated by reference in this document.
[0183] [0183] In some embodiments, -X-Y- is -O-CRaRb-, where neither Ra nor Rb is hydrogen, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. In certain embodiments, Ra and Rb are both alkyl at the same time, in particular, both methyl at the same time. Such 6 'disubstituted LNA nucleosides are described in WO 2009/006478, which is incorporated herein by reference.
[0184] [0184] In some embodiments, -X-Y- is -S-CHRa-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such 6 'substituted LNA nucleosides are described in WO 2011/156202, which is incorporated herein by reference. In certain embodiments of such a 6 'substituted LNA, Ra is alkyl, in particular methyl.
[0185] [0185] In some embodiments, -X-Y- is -C (= CH2) C (RaRb) -, just as W is oxygen, and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. Such vinyl carbo LNA nucleosides are described in WO 2008/154401 and WO 2009/067647, which are hereby incorporated by reference.
[0186] [0186] In some embodiments, -X-Y- is -N (ORa) -CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. In some embodiments, Ra is alkyl, such as methyl. Such LNA nucleosides are also known as N substituted LNAs and are described in WO 2008/150729, which is incorporated herein by reference.
[0187] [0187] In some embodiments, -X-Y- is -O-NCH3- (Seth et al., J. Org. Chem 2010 op. Cit.).
[0188] [0188] In some modalities, -XY- is ON (Ra) - –N (Ra) -O-, -NRa- CRaRb-CRaRb-, or –NRa-CRaRb-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. In certain embodiments, Ra is alkyl, just like methyl. (Seth et al., J. Org. Chem 2010 op. Cit.).
[0189] [0189] In some modalities, R5 and R5 * are both hydrogens at the same time. In other embodiments, one of R5 and R5 * is hydrogen and the other is alkyl, such as methyl. In such embodiments, R1, R2 and R3 can be, in particular, hydrogen, and -XY- can be, in particular, - O-CH2- or -O-CHC (Ra) 3-, such as -O-CH ( CH3) -.
[0190] [0190] In some embodiments, -XY- is -CRaRb-O-CRaRb-, such as -CH2-O-CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. In such embodiments, Ra may be, in particular, alkyl, such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are described in WO 2013/036868, which is incorporated herein by reference.
[0191] [0191] In some embodiments, -XY- is -O-CRaRb-O-CRaRb-, such as -O-CH2-O-CH2-, W is oxygen and R1, R2, R3, R5 and R5 * are all hydrogen at the same time. In certain embodiments, Ra may be, in particular, alkyl, such as methyl. Such LNA nucleosides are also known as COC nucleotides and are described in Mitsuoka et al., Nucleic Acids Research 2009, 37 (4), 1225-1238, which is incorporated herein by reference.
[0192] [0192] It will be recognized that, unless specified, LNA nucleosides may be in the beta-D or alpha-L stereoisoform.
[0193] [0193] Certain examples of LNA nucleosides are shown in Scheme 1.
[0194] [0194] As illustrated elsewhere, in some embodiments of the description the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides. II.E. Nuclease-mediated degradation
[0195] [0195] Nuclease-mediated degradation refers to an oligonucleotide capable of mediating the degradation of a complementary nucleotide sequence by forming a duplex with such a sequence.
[0196] [0196] In some embodiments, the oligonucleotide may function via nuclease-mediated degradation of the target nucleic acid, where the oligonucleotides of the description are able to recruit a nuclease, particularly, and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs that operate via nuclease-mediated mechanisms are oligonucleotides that typically comprise a region of at least 5 or 6 nucleosides of DNA and are flanked on one side or on both sides by nucleosides that increase affinity, for example, gapmers , headmers and tailmers. II.F. RNaseH Activity and Recruitment
[0197] [0197] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule and induce degradation of the complementary RNA molecule. WO01 / 23613 provides in vitro methods for determining RNaseH activity, which can be used to determine the ability to recruit RNaseH. An oligonucleotide is normally considered capable of recruiting RNaseH if, when supplied with a complementary target nucleic acid sequence, it has an initial rate, measured in pmol / l / min, of at least 5%, such as at least 10%, or more than 20% of the initial rate determined when using an oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers, with phosphorothioate bonds between all monomers in the oligonucleotide and using the methodology provided by Examples 91-95 of WO01 / 23613.
[0198] [0198] In some embodiments, an oligonucleotide is considered essentially incapable of recruiting RNaseH if, when supplied with the complementary target nucleic acid, the initial rate of
[0199] [0199] The ASO of the description may comprise a nucleotide sequence comprising both nucleosides and nucleoside analogs, and may be in the form of a gapmer, blockmer, mixmer, headmer, tailmer or totalmer. Examples of configurations for a gapmer, blockmer, mixmer, headmer, tailmer or totalmer that can be used with the description ASO are described in Publ. of U.S. Patent Application No. 2012/0322851.
[0200] [0200] The term "gapmer", as used in this document, refers to an antisense oligonucleotide comprising an RNase H recruiting oligonucleotide region (gap), which is flanked 5 'and 3' by one or more modified nucleosides that increase affinity (flanks). The terms "headmers" and "tailmers" are oligonucleotides capable of recruiting RNase H where one of the flanks is absent, that is, only one end of the oligonucleotide comprises modified nucleosides that increase affinity. For headmers, flank 3 'is absent (ie, flank 5' comprises modified nucleosides that increase affinity), and for tailmers flank 5 'is absent (ie, flank 3' comprises modified nucleosides that increase affinity). The term "gapmer LNA" is a gapmer oligonucleotide in which at least one of the modified affinity-increasing nucleosides is an LNA nucleoside. The term "mixed flank gapmer" refers to an LNA gapmer in which the flank regions comprise at least one nucleoside LNA and at least one nucleoside DNA or nucleoside unmodified by LNA, such as at least one modified nucleoside substituted in 2 ', such as, for example, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino- DNA, 2'-Fluoro-RNA, 2'-Fluro-DNA, arabic nucleic acid (ANA), and 2'-Fluoro-ANA nucleoside (s).
[0201] [0201] Other "chimeric" ASOs, called "mixers", consist of an alternative composition of (i) DNA monomers or nucleoside analog monomers recognizable and cleavable by RNase, and (ii) analogous nucleoside monomers that do not recruit RNase .
[0202] [0202] A "totalmer" is a single-stranded ASO comprising only naturally occurring nucleotides or nucleotide analogues.
[0203] [0203] In some modalities, in addition to increasing the affinity of ASO to the target region, some nucleoside analogs also mediate the binding and cleavage of RNase (for example, RNaseH). Since α-L-LNA monomers recruit RNaseH activity to some extent, in some embodiments, the gap regions (for example, region B, as referred to in this document) of ASOs containing α-L-LNA monomers consist of less monomers recognizable and cleavable by RNaseH and more flexibility is introduced in the construction of mixers. II.G.1. Gapmer design
[0204] [0204] In some embodiments, the ASO of the description is a gapmer and comprises a contiguous range of nucleotides (for example, one or more DNA) that is capable of recruiting an RNase, such as RNaseH, in this document referred to as region B ( B), in which region B is flanked in both 5 'and 3' by regions of nucleoside analogues 5 'and 3' to the contiguous range of nucleotides in region B - these regions are referred to as regions A (A) and C (C), respectively. In some embodiments, nucleoside analogs are sugar modified nucleosides (for example, high affinity sugar modified nucleosides). In certain embodiments, the sugar-modified nucleosides of regions A and C increase the affinity of the ASO with the target nucleic acid (i.e., 2 'sugar-modified nucleosides that increase affinity). In some embodiments, the sugar modified nucleosides are 2 'sugar modified nucleosides, such as high affinity 2' sugar modifications, such as LNA or 2'-MOE.
[0205] [0205] In a gapmer, most of the 5 'and 3' nucleosides of region B are DNA nucleosides and are positioned adjacent to nucleoside analogs (for example, high affinity sugar modified nucleosides) from regions A and C, respectively . In some embodiments, regions A and C can be further defined by having nucleoside analogs at the farthest end of region B (i.e., at the 5 'end of region A and at the 3' end of region C).
[0206] [0206] In some embodiments, the ASOs of the present description comprise a nucleotide sequence of formula (5 'to 3') AB-C, in which: (A) (region 5 'or a first flank sequence) comprises at least a nucleoside analog (for example, 3-5 LNA units); (B) comprises at least four consecutive nucleosides (for example, 4-24 DNA units), which are capable of recruiting RNase (when formed in a duplex with a complementary RNA molecule, such as the pre-mRNA or target mRNA) ; and (C) (3 'region or a second flank sequence) comprises at least one nucleoside analog (for example, 3-5 LNA units).
[0207] [0207] In some embodiments, region A comprises 3-5 nucleotide analogs, such as LNA, region B consists of 6-24 (for example, 6, 7, 8, 9, 10, 11, 12, 13 or 14) DNA units, and the C region consists of 3 or 4 nucleotide analogs, such as LNA. Such designs include (ABC) 3-14-3, 3-11-3, 3-12-3, 3-13-3, 4-9-4, 4- 10-4, 4-11-4, 4- 12-4 and 5-10-5. In some modalities, the ASO has a design of LLLDnLLL, LLLLDnLLLL or LLLLLDnLLLLL, where L is a nucleoside analog, D is DNA and n can be any integer between 4 and 24. In some modalities, n can be any integer between 6 and 14. In some embodiments, n can be any integer between 8 and 12.
[0208] [0208] Other gapmer designers are described in WO2004 / 046160, WO 2007/146511 and WO2008 / 113832, each being incorporated herein by reference in its entirety. II.H. Internucleotide Bonds
[0209] [0209] The monomers of the ASOs described in this document are coupled together by means of linking groups. Suitably, each monomer is attached to the adjacent 3 'monomer by means of a linking group.
[0210] [0210] The person skilled in the art would understand that, in the context of the present description, the monomer 5 'at the end of an ASO does not comprise a 5' linking group, although it may or may not comprise a 5 'terminal group.
[0211] [0211] The terms "linking group" or "internucleoside bond" are intended to mean a group capable of covalently coupling two nucleosides to each other. Specific and preferred examples include phosphate groups and phosphorothioate groups.
[0212] [0212] The ASO nucleosides of the description, or their contiguous nucleoside sequence, are coupled together by means of linking groups. Suitably, each nucleoside is linked to the adjacent 3 'nucleoside by means of a linking group.
[0213] [0213] In some embodiments, the internucleoside bond is changed from its normal phosphodiester to one that is more resistant to nuclease attack, such as phosphorothioate, which is cleavable by RNaseH, also allows the antisense inhibition pathway to reduce the expression of target gene. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, in at least 96%, at least 97%, at least 98%, at least 99% or 100% of internucleoside bonds are modified. II.I. Conjugated
[0214] [0214] The term conjugate, as used herein, refers to an ASO that is covalently linked to a non-nucleotide moiety (conjugated moiety or C region or third region).
[0215] [0215] Conjugation of the description's ASO to one or more non-nucleotide moieties can improve the pharmacology of ASO, for example, affecting ASO activity, cell distribution, cell absorption or stability. In some embodiments, the non-nucleotide moieties modify or increase the pharmacokinetic properties of ASO, improving cell distribution, bioavailability, metabolism, excretion, permeability and / or cellular absorption of ASO. In certain embodiments, the non-nucleotide moieties can target the ASO to a specific organ, tissue or cell type and thus increase the effectiveness of the ASO in that organ, tissue or cell type. In other embodiments, the non-nucleotide moieties reduce ASO activity in non-target cell, tissue or organ types, for example, off-target activity or activity in non-target cell, tissue or organ types. WO 93/07883 and WO2013 / 033230 provide suitable conjugated portions. Other suitable conjugated moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr). In particular, conjugated portions of trivalent N-acetylgalactosamine are suitable for binding to the ASGPr, see, for example, WO 2014/076196, WO 2014/207232 and WO 2014/179620, each being incorporated herewith by reference.
[0216] [0216] In some embodiments, the non-nucleotide portion (conjugated portion) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (for example) bacterial toxins), vitamins, viral proteins (eg capsids) and their combinations. II.J. Activated ASOs
[0217] [0217] The term “activated ASO”, as used in this document, refers to an ASO that is covalently linked (ie functionalized) to at least one functional component that allows the covalent attachment of the ASO to one or more conjugated moieties, that is, moieties other than nucleic acids or monomers themselves, to form the conjugates described herein. Typically, a functional component will comprise a chemical group that is capable of covalently bonding to the ASO, by means of, for example, a 3'-hydroxyl group or the exocyclic NH2 group of the adenine base, a spacer that can be hydrophilic and a group terminal that is able to bind to a conjugated moiety (for example, an amino, sulfhydryl or hydroxyl group). In some embodiments, this terminal group is not protected, for example, it is an NH2 group. In other modalities, the terminal group is protected, for example, by any suitable protection group, such as those described in “Protective Groups in Organic Synthesis” by Theodora W Greene and Peter GM Wuts, 3rd edition (John Wiley & Sons, 1999 ), which is hereby incorporated by reference.
[0218] [0218] In some embodiments, the ASOs of the description are functionalized at the 5 'end, in order to allow covalent attachment of the conjugated portion to the 5' end of the ASO. In other embodiments, the ASOs of the description can be functionalized at the 3 'end. In still other embodiments, the ASOs of the description can be functionalized along the main chain or in the heterocyclic base portion. In still other embodiments, ASOs of the description can be functionalized in more than one position independently selected from the 5 'end, the 3' end, the main chain and the base.
[0219] [0219] In some embodiments, the activated ASOs of the description are synthesized by the incorporation during the synthesis of one or more monomers that are covalently linked to a functional component. In other modalities, the activated ASOs of the description are synthesized with monomers that have not been functionalized and the ASO is functionalized after completion of the synthesis. III. Pharmaceutical Compositions and Routes of Administration
[0220] [0220] The ASO of the description can be used in pharmaceutical formulations and compositions. In some embodiments, such compositions comprise a pharmaceutically acceptable diluent, carrier, salt or adjuvant. In certain embodiments, a pharmaceutically acceptable salt comprises a sodium salt, a potassium salt or an ammonium salt.
[0221] [0221] The ASO of the description can be included in a unit formulation, such as in a pharmaceutically acceptable carrier or diluent, in an amount sufficient to supply a patient with a therapeutically effective amount without causing serious side effects in the treated patient. However, in some forms of therapy, serious side effects may be acceptable, in terms of ensuring a positive outcome for therapeutic treatment.
[0222] [0222] The formulated drug may comprise pharmaceutically acceptable binding agents and adjuvants. Capsules, tablets or pills may contain, for example, the following compounds: microcrystalline cellulose, gum or gelatin as binders; starch or lactose as excipients; stearates as lubricants; various sweetening or flavoring agents. For capsules, the dosage unit may contain a liquid carrier such as fatty oils. Likewise, sugar coatings or enteric agents can be part of the dosage unit. ASO formulations can also be emulsions of the active pharmaceutical ingredients and a lipid forming a micellular emulsion.
[0223] [0223] The pharmaceutical compositions of the present description can be administered in several ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be (a) oral; (b) pulmonary, for example, by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, (c) topical, including epidermal, transdermal, ophthalmic and mucous membranes, including vaginal and rectal supply; or (d) parenteral, including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, for example, intrathecal, intracerebroventricular or intraventricular administration. In some modalities, ASO is administered intravenously, intraperitoneally, orally, topically or as a bolus injection or administered directly into the target organ. In some modalities, ASO is administered intracardially or intraventricularly as a bolus injection. In some modalities, ASO is administered subcutaneously. In some modalities, ASO is administered orally.
[0224] [0224] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments,
[0225] [0225] The pharmaceutical compositions of the present description include, but are not limited to, solutions, emulsions and formulations containing liposomes. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semi-solids. Drug supply to the target tissue can be increased by vehicle-mediated distribution, including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethyleneimine polymers, nanoparticles and microspheres (Dass CR. J. Pharm Pharmacol 2002; 54 (1): 3-27).
[0226] [0226] The pharmaceutical formulations of the present description, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of associating the active ingredients with the pharmaceutical carrier (s) or excipient (s). In general, formulations are prepared by uniformly and intimately associating the active ingredients with liquid vehicles or finely divided solid vehicles or both, and then, if necessary, shaping the product.
[0227] [0227] For parenteral, subcutaneous, intradermal or topical administration, the formulation can include a sterile diluent, buffers, tonicity regulators and antibacterials. Active ASOs can be prepared with vehicles that protect against degradation or immediate elimination from the body, including implants or microcapsules with controlled release properties. For intravenous administration, the vehicles can be physiological saline or phosphate buffered saline. International Publication No. WO2007 / 031091 (A2), published on March 22, 2007, further provides suitable pharmaceutically acceptable diluent, carrier and adjuvants - which are hereby incorporated by reference. IV. Diagnostics
[0228] [0228] This description also provides a useful diagnostic method when diagnosing cardiovascular diseases, for example, heart failure. Non-limiting examples of cardiovascular diseases that can be diagnosed with the present ASOs include, but are not limited to, coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, carditis of valvular heart disease, aortic aneurysms, peripheral arterial disease, thromboembolic disease and venous thrombosis. In some modalities, heart failure comprises heart failure on the left side, heart failure on the right side, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF) , heart failure with a mid-range ejection fraction (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD) or hypertrophic hypertrophic cardiomyopathy.
[0229] [0229] The ASOs of the description can be used to measure the expression of the CAMK2D transcript in an individual's body tissue or fluid and compare the measured expression level with a standard CAMK2D transcription expression level in normal tissue or body fluid , in which an increase in the level of expression compared to the standard is indicative of a disorder treatable by an ASO of the description.
[0230] [0230] The ASOs of the description can be used to test the levels of CAMK2D transcription in a biological sample using any methods known to those skilled in the art. (Touboul et. Al., Anticancer Res. (2002) 22 (6A): 3349-56; Verjout et. Al., Mutat. Res. (2000) 640: 127-38); Stowe et. al., J. Virol. Methods (1998) 75 (1): 93-91).
[0231] [0231] The term "biological sample" refers to any biological sample obtained from an individual, cell line, tissue culture or other source of cells that potentially express the transcription of CAMK2D. Methods for obtaining this biological sample from mammals are well known in the art. V. Kits comprising ASOs
[0232] [0232] This description further provides kits that comprise an ASO of the description in this document described and that can be used to perform the methods described in this document. In certain embodiments, a kit comprises at least one ASO in one or more containers. In some modalities, the kits contain all the necessary and / or sufficient components to perform a detection test, including all controls, instructions for carrying out tests, and any software necessary for analysis and presentation of the results. One skilled in the art will readily recognize that the described ASO can be readily incorporated into one of the established kit formats which are well known in the art.
[0233] [0233] The ASOs of the description can be used as research reagents for, for example, diagnosis, therapy and prophylaxis.
[0234] [0234] In research, such ASOs can be used to specifically inhibit CAMK2D protein synthesis (typically degrading or inhibiting mRNA and thus preventing protein formation) in cells and experimental animals, thus facilitating functional analysis of the target or an assessment of its usefulness as a target for therapeutic intervention. Also provided are methods of downregulating the expression of CAMK2D mRNA and / or CAMK2D protein in cells or tissues, which comprise contacting cells or tissues, in vitro or in vivo, with an effective amount of one or more of the ASOs, conjugates or compositions of the description.
[0235] [0235] In diagnostics, ASOs can be used to detect and quantify the expression of CAMK2D transcription in cells and tissues by Northern blotting, in situ hybridization, or similar techniques.
[0236] [0236] As for therapy, an animal or a human being suspected of having a disease or disorder that can be treated by modulating the expression of the CAMK2D and / or CAMK2D protein transcription is treated by the administration of ASOs in accordance with this description. In addition, methods of treating a mammal, such as treating a human being suspected of having or being prone to a disease or condition, are associated with increased expression of the CAMK2D and / or CAMK2D protein transcription, by administration of a therapeutic or prophylactically effective amount of one or more ASOs or compositions of the description. ASO, a conjugate or a pharmaceutical composition, according to the description, is typically administered in an effective amount. In some embodiments, the ASO or conjugate of the description is used in therapy.
[0237] [0237] The description further provides an ASO according to the description, for use in the treatment of one or more of the cardiovascular diseases referred to in this document, such as a disease selected from coronary artery disease, stroke, heart failure, heart disease hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, heart valve heart disease, aortic aneurysms, peripheral arterial disease, thromboembolic disease and venous thrombosis.
[0238] [0238] In certain modalities, the disease, disorder or condition is associated with overexpression of the transcription of the CAMK2D gene and / or the CAMK2D protein.
[0239] [0239] The description also provides methods of inhibiting (for example, reducing) the expression of the CAMK2D gene and / or CAMK2D protein transcription in a cell or tissue, the method comprises contacting the cell or tissue, in vitro or in vivo, with an effective amount of one or more ASOs, conjugates or their pharmaceutical compositions, of the description, to affect the degradation of the expression expression of the CAMK2D gene, thereby reducing the CAMK2D protein.
[0240] [0240] The description also provides the use of ASO or conjugate of the description, as described, for the manufacture of a medicament for the treatment of a disorder, as referred to herein, or for a method of treating a disorder, as referred to in this document.
[0241] [0241] The description further provides a method for inhibiting or reducing the CAMK2D protein in a cell expressing CAMK2D, comprising administering an ASO or a conjugate, according to the description, to the cell in order to affect inhibition or reduction of the CAMK2D protein in the cell.
[0242] [0242] The description includes a method to reduce, improve, prevent or treat the hyperexcitability of motor neurons (for example, such as those found in cardiomyocytes) in an individual in need, comprising administering an ASO or a conjugate according to the description.
[0243] [0243] The description also provides a method for the treatment of a disorder, as referred to in this document, the method comprising administering an ASO or a conjugate according to the description, and / or a pharmaceutical composition, according to description, to a patient in need.
[0244] [0244] ASOs and other compositions according to the description can be used for the treatment of conditions associated with overexpression of the CAMK2D protein.
[0245] [0245] In general, one aspect of the description is directed to a method of treating a mammal that suffers or is susceptible to conditions associated with abnormal levels of CAMK2D, comprising administering to the mammal a therapeutically effective amount of an ASO directed to the transcription of CAMK2D, which comprises one or more LNA units. ASO, a conjugate or a pharmaceutical composition, according to the description, is typically administered in an effective amount.
[0246] [0246] An interesting aspect of the description is the use of an ASO (compound), as defined in this document, or a conjugate, as defined in this document, for the preparation of a drug for the treatment of a disease, disorder or condition, as referred to in this document.
[0247] [0247] The methods of the description can be used for the treatment or prophylaxis against diseases caused by abnormal levels of the CAMK2D protein. In some modalities, diseases caused by abnormal levels of CAMK2D protein are cardiovascular diseases. In certain embodiments, cardiovascular disease may include coronary artery disease, stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral arterial disease , thromboembolic disease, and venous thrombosis.
[0248] [0248] In certain modalities, cardiovascular disease is heart failure, which may include heart failure on the left side, heart failure on the right side, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), a heart failure with preserved ejection fraction (HFpEF), heart failure with intermediate range ejection fraction (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD), or hypertrophic hypertensive cardiomyopathy.
[0249] [0249] Alternatively cited, in some embodiments, the description is furthermore directed to a method for treating abnormal levels of CAMK2D protein, the method comprising administering an ASO of the description, or a conjugate of the description, or a pharmaceutical composition from description to a patient in need.
[0250] [0250] The description also refers to an ASO, composition or conjugate, as defined in this document, for use as a medicine.
[0251] [0251] The description further refers to the use of a compound, composition or conjugate, as defined in this document, for the manufacture of a medicament for the treatment of abnormal levels of CAMK2D protein or expression of mutant forms of CAMK2D protein (such as as allelic variants, where allelic variants are associated with one of the diseases referred to in this document).
[0252] [0252] A patient in need of treatment is a patient who is suffering or is likely to suffer from the disease or disorder.
[0253] [0253] The practice of this description will use, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology, which are within the skill of the art. Such techniques are fully explained in the literature. See, for example, Sambrook et al., Ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed .; Cold Spring Harbor Laboratory Press); Sambrook et al., Ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N. Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. Pat. No. 4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al., Eds., Methods In Enzymology, Vols. 154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); ); Crooke, Antisense drug Technology:
[0254] [0254] All references cited above, as well as all references cited in this document, are incorporated herein by reference in their entirety.
[0255] [0255] The following examples are offered by way of illustration and not by way of limitation.
[0256] [0256] The antisense oligonucleotides described in this document have been designed to target various regions in the CAMK2D pre-mRNA (SEQ ID NO: 1). SEQ ID NO: 1 shows the genomic sequence of CAMK2D, which corresponds to the reverse complement of residues 113,451,032 to 113,761,927 from GenBank Access No. NC_000004.12. For example, ASOs were built to target the indicated regions using the start and end sites of SEQ ID NO: 1, as shown in Figures 1A and 1B. Exemplary sequences of the ASOs of the present description are provided in Figures 1A and 1B. In some embodiments, ASOs have been designated to be gapmers, as shown in FIGURE 3. The described gapmers have been constructed to contain blocked nucleic acids - LNAs (capital letters). For example, a gapmer can have beta-deoxy LNA at the 5 'and 3' ends and have a phosphorothioate backbone. However, the LNA can also be replaced by any other nucleoside analogs and the main chain can be other types of structures (e.g., phosphodiester bond, phosphotriester bond, methylphosphonate bond, phosphoramidate bond or any combination thereof).
[0257] [0257] ASOs were synthesized using methods well known in the art. Exemplary methods of preparing such ASOs are described in Barciszewski et al., Chapter 10 - “Locked Nucleic Acid Aptamers” in Nucleic Acid and Peptide Aptamers: Methods and Protocols, vol. 535, Gunter Mayer (ed.) (2009), the entire content of which is hereby expressly incorporated into this document by reference. Example 2: qPCR assay to measure CAMK2D mRNA reduction in HEK293 cells
[0258] [0258] The ASOs of this description have been tested for their ability to reduce the expression of CAMK2D mRNA in human embryonic kidney cells (HEK293) (European Collection of Authenticated Cell Cultures (ECACC), catalog number 85120602). HEK293 cells were cultured in cell culture medium (DMEM AQ D0819, 10% FBS and Pen / Estrep). Every 5 days, the cells were trypsinized by washing with phosphate buffered saline (PBS), followed by the addition of 0.25% trypsin-EDTA solution, incubation for 2-3 minutes at 37 ° C, and trituration before seeding the cells. The cells were maintained in culture for up to 15 passages.
[0259] [0259] For experimental use, 3,500 cells per well were seeded in 96-well plates in 100 µL of growth medium. ASOs were prepared from a 750 µM stock and dissolved in PBS. Approximately 24 hours after sowing the cells, ASOs were added to the cells at a final concentration of 25 µM. The cells were then incubated for 3 days without any change in medium. After incubation, cells were harvested by removing medium followed by the addition of 125 µL of PURELINK®Pro 96 lysis buffer and 125 µL of 70% ethanol. Then, the RNA was purified according to the manufacturer's instructions and eluted in a final volume of 50 µL of water, resulting in an RNA concentration of 10-20 ng / µL. Then, the RNA was diluted 10 times in water before the one-step qPCR reaction.
[0260] [0260] For the one-step qPCR reaction, qPCR-mix (qScriptTMXLE 1 step RT-qPCR TOUGHMIX®Low ROX, from QauntaBio) was mixed with two Taqman probes in a 10: 1: 1 ratio (qPCR-mix: probe1 : sonda2) to generate the mastermix. Taqman probes were purchased from LifeTechnologies: CAMK2D_ Hs009943538_m1; GAPDH 4325792. The mastermix (6 µL) and RNA (4 µL, 1-2 ng / µL) were then mixed on a qPCR plate (MICROAMP® optical 384-well, catalog no. 4309849). After sealing the plate, the plate was subjected to a rapid rotation, 1000 g for 1 minute at room temperature, and transferred to a ViiaTM 7 system (Applied Biosystems, Thermo). The following PCR conditions were used: 50 ° C for 15 minutes; 95 ° C for 3 minutes; 40 cycles of: 95 ° C for 5 seconds, followed by a temperature drop of 1.6 ° C / s, followed by 60 ° C for 45 seconds. The data were analyzed using the QuantStudio ™ Real_time PCR software. The percentage inhibition for samples treated with ASO was calculated in relation to the samples treated for control. The results are shown in Figures 2 and 4. Example 3: QUANTIGENE® analysis (96-well assay) to measure the reduction of CAMK2D mRNA in cardiomyocytes derived from human inducible pluripotent stem cells (hiPSC-CM)
[0261] [0261] The ability of ASOs to reduce human CAMK2D mRNA was measured in vitro by QUANTIGENE® analysis. Cardiomyocytes derived from human inducible pluripotent stem cells (hiPSC-CMs) from Cellular Dynamics International cells (“iCell2”) were thawed, spread on plates and cultured according to the manufacturer's instructions. These cardiomyocytes are derived from human-induced pluripotent stem cells, which were first successfully differentiated into functional cardiomyocytes in 2009. Zhang et al., Circ Res 104 (4): 230-41 (2009). Since then, hiPSC-CMs have been used to study various aspects of the human heart and related diseases. Since these cells carry the genetic traits of the human donors from which they are obtained, they are often better indicators of human physiology or pathophysiology compared to existing animal models. Blazeski et al., Prog Biophys Mol Biol 110: 166-177 (2012).
[0262] [0262] Workflow: Before sowing cells, 96-well plates pre-coated with collagen were coated with fibronectin as follows. Fibronectin (1 mg / ml) was diluted 1: 100 in PBS (-Ca2 +, -Mg2 +) and 50 µL of diluted fibronectin solution was added to each well of the 96-well plate. The plate was gently agitated horizontally to ensure a uniform fibronectin coating at the bottom of each well. Then, the plates were incubated at 37 ° C for 90 minutes. The cells were added to the plates immediately after aspiration of the fibronectin solution, according to the manufacturer's instructions. The cells were seeded at
[0263] [0263] After incubation, the medium was removed and the cells lysed as follows. The lysis buffer of the working cells was made by adding 1 part of proteinase K to 99 parts of QUANTIGENE® 3x lysis buffer and then diluting 1: 3 in dH2O. Working lysis buffer was added to the plates at 220 µL / well. After adding lysis buffer, the plate was shaken on a plate shaker for 10 minutes at medium speed (i.e., speed 5-6 out of 10). The plates were then incubated at 55 ° C for 30 minutes. After this incubation, the lysates were either frozen at -80 ° C or tested immediately. The measurement of the lysate mRNA was performed using the QUANTIGENE® 2.0 Reagent System (AFFYMETRIX®), which quantifies RNA using a branched DNA signal amplification method dependent on the specifically designed target RNA capture probe set.
[0264] [0264] Assay: Each well of the capture plate (96-well polystyrene plate coated with capture probes) was loaded with 20 µL of working probe set. The working probe set reagents were generated by combining nuclease-free water (12.05 µL), lysis mixture (6.65 µL), blocking reagent (1 µL) and specific 2.0 probe set (0, 3 µL) (human CAMK2D catalog # SA-3000428 or human POLR2A catalog # SA-10004), according to the manufacturer's instructions (QUANTIGENE® 2.0 AFFYMETRIX®). Cell lysates (or 1x lysis buffer for use in blank background control wells) were then added to the capture plates in a volume of 80 µL / well, providing 100 µL of total fluid per well. The plates were sealed using the QUANTIGENE® sheet seal in combination with a crank sealer. The plates were centrifuged at 240g for 60 seconds and then incubated for 16-20 hours at 55 ° C to hybridize (capture of target RNA).
[0265] [0265] Signal amplification and target RNA detection started by washing the plates with wash buffer 3 times (200, 300, and 300 µL / well in series, with buffer removal between each step) to remove any unused material. on, followed by an inverted centrifugation step for 1 min at 240g to dry the wells. Then, the 2.0 Pre-Amplifier hybridization reagent (100 µL / well) was added, incubated at 55 ° C for 1 hour, then aspirated, and the wash buffer was added and aspirated 3 times (200, 300 and 300 µL) / well in series, with the removal of buffer between each step), followed by an inverted centrifugation step for 1 min at 240g to dry the wells. The 2.0 Amplifier hybridization reagent was then added (100 µL / well), incubated for 1 hour at 55 ° C and then the washing, aspiration and drying steps were repeated as described above. The 2.0 Label Probe hybridization reagent was then added (100 µL / well), incubated for 1 hour at 50 ° C and then the washing, aspiration and drying steps were repeated as previously described. Then 2.0 Substrate was added (100 µL / well) to the plates. The plates were incubated for 5 minutes at room temperature and then imaged in a PerkinElmer Envision multilabel plate reader in luminometer mode in 15 minutes.
[0266] [0266] Data determination: For the gene of interest, the mean background signal of the assay was subtracted from the mean signal of each technical repetition. The mean background signals subtracted for the gene of interest were then normalized to the mean background signal subtracted for the POLR2A maintenance mRNA. The percentage inhibition for the treated sample was calculated in relation to the lysate of the treated control sample. The results of the QUANTIGENE® assays for cells treated with ASOs at a concentration of 500 nM are provided in FIGURE 4. Example 4: Analysis of CAMK2D mRNA Reduction In Vivo
[0267] [0267] To assess the potency of ASOs in reducing the level of CAMK2D mRNA in vivo, female C57BL / 6J Good mice were administered subcutaneously with one of the ASOs shown in FIGURE 5. The ASOs were administered at a dose of 30 mg / kg / day for three consecutive days (days 1, 2 and 3). Mice were observed for changes in behavior and body weight. The mice were sacrificed on day 8 and cardiac tissue was harvested for RNA isolation and analysis, as described below.
[0268] [0268] The lysis buffer of MagNA Pure tissue (Roche) was added to the cardiac tissue section and homogenized using stainless steel beads until a uniform lysate was obtained. Incubation for 30 minutes at room temperature completed the lysis. RNA was isolated using MagNA Pure96 (Roche) with the Cellular RNA Large Volume kit.
[0269] [0269] RNA concentration was normalized to 5 ng / µl, and one-step qPCR was performed using 20 ng of RNA, qPCR Taqman Mastermix, and the following Taqman probes: CAMK2D (Thermo Mm00499266_m1) and GAPDH (Thermo 4352339E).
[0270] [0270] The PCR conditions were as follows: 50 ° C for 15 minutes; 95 ° C for 3 minutes; 40 cycles of: 95 ° C for 5 seconds. The data were analyzed using the QUANTSTUDIOTM Real-time PCR software. The percentage inhibition for samples treated with ASO was calculated in relation to samples treated with saline solution.
[0271] [0271] As shown in FIGURE 5, all ASOs tested were able to decrease the level of CAMK2D mRNA when administered to C57BL / 6J Good mice. Collectively, the results provided in this document demonstrate the potency of ASOs both in vitro and in vivo, and support that specific CAMK2D ASOs are disease-modifying therapies for the treatment of various medical disorders, such as associated cardiovascular diseases or disorders.
[0272] [0272] This PCT application claims the priority benefit of U.S. Provisional Application Nos. 62 / 633,502, filed on February 21,
2018; 62 / 635,954, filed on February 27, 2018; 62 / 665,998 deposited on May 2, 2018; and 62 / 778,679, filed on December 12, 2018, each being incorporated in this document by reference in its entirety.

权利要求:
Claims (3)
[1]
1. Antisense oligonucleotide (ASO), characterized by the fact that it comprises a sequence of contiguous nucleotides from 10 to 30 nucleotides in length that is complementary, as well as completely complementary, to a nucleic acid sequence in a calcium-dependent protein kinase transcription / delta II calmodulin (CAMK2D).
[2]
2. ASO according to claim 1, or its contiguous nucleotide sequence, characterized by the fact that it is at least about 80%, at least about 85%, at least about 90%, at least about 95% , or about 100% complementary to the nucleic acid sequence within the CAMK2D transcript.
[3]
3. ASO according to claim 1 or 2, characterized by the fact that the CAMK2D transcript is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.
ASO according to any one of claims 1 to 3, characterized in that ASO is capable of reducing the expression of the CAMK2D protein in a human cell (for example, HEK293 cell) which expresses the CAMK2D protein.
5. ASO according to claim 4, characterized in that the expression of the CAMK2D protein is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45% at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the expression of the CAMK2D protein in a human cell that is not exposed to ASO.
6. ASO according to any of the claims
1 to 5, characterized by the fact that it is able to reduce the expression of the CAMK2D transcription (for example, mRNA) in a human cell (for example, HEK293 cell), which is expressing the CAMK2D transcription.
7. ASO according to claim 6, characterized in that the expression of the CAMK2D transcript is reduced by at least about 30%, at least about 35%, at least about 40%, at least about 45 %, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80% at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the expression of CAMK2D transcription in a human cell that is not exposed to ASO.
8. ASO according to any one of claims 1 to 7, characterized by the fact that the ASO is a gapmer.
9. ASO according to any one of claims 1 to 8, characterized by the fact that ASO has a design of LLLDnLLL, LLLLDnLLLL, or LLLLLDnLLLLL, where L is a nucleoside analog, D is DNA, and n can be any integer between 4 and
24.
10. ASO according to claim 9, characterized by the fact that n can be any integer between 6 and 14.
11. ASO according to claim 9, characterized by the fact that n can be any integer between 8 and 12.
ASO according to any one of claims 9 to 11, characterized in that the nucleoside analog comprises a 2'-O-alkyl-RNA; 2'-O-methyl-RNA (2'-OMe); 2'-alkoxy-RNA; 2'-O-methoxyethyl-RNA (2'-MOE); 2'-amino-DNA; 2'-fluro-RNA; 2'-fluoro-DNA; arabic nucleic acid (ANA); 2'-fluoro-ANA; or bicyclic nucleoside analog (LNA).
13. ASO according to any one of claims 9 to 12, characterized in that one or more of the nucleoside analogs is a sugar modified nucleoside.
14. ASO according to claim 13, characterized in that the sugar-modified nucleoside is a 2 'sugar-modified nucleoside that increases affinity.
ASO according to any one of claims 9 to 12, characterized in that one or more of the nucleoside analogs comprises a nucleoside containing a bicyclic sugar.
16. ASO according to claim 14, characterized by the fact that the 2 'sugar-modified nucleoside that increases affinity is an LNA.
17. ASO according to claim 16, characterized by the fact that the LNA is selected from the group consisting of ethyl nucleoside restricted (cEt), 2'-O-methoxyethyl 2 ', 4'-restricted (cMOE), α- L-LNA, β-D-LNA, 2'-O, 4'-C-ethylene (ENA) bridged nucleic acids, amino-LNA, oxide-LNA, thio-LNA, or any combination thereof.
18. ASO according to any one of claims 1 to 17, characterized in that the ASO comprises one or more 5'-methyl cytosine nucleobases.
19. ASO according to any one of claims 1 to 18, characterized by the fact that ASO is capable of (i) reducing the level of mRNA encoding CAMK2D in inducible pluripotent stem cell-derived cardiomyocytes (hiPSC-CM); (ii) reducing the level of CAMK2D protein in hiPSC-CM; (iii) reduce, improve or treat one or more symptoms of a cardiovascular disease or disorder, and (iv) any combinations thereof.
20. ASO according to any of the claims
1 to 19, characterized by the fact that the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising (i) nucleotides 625-842 of SEQ ID NO: 1; (ii) 1,398 - 59,755 nucleotides of SEQ ID NO: 1; (iii) nucleotides 61,817 - 104,725 of SEQ ID NO: 1; (iv) nucleotides 112,162 - 118,021 of SEQ ID NO: 1; (v) nucleotides 119,440 - 135,219 of SEQ ID NO: 1; (vi) nucleotides 137,587 - 157,856 of SEQ ID NO: 1; (vii) nucleotides
159,191 - 266,174 of SEQ ID NO: 1; or (viii) nucleotides 272,788 -
310,949 of SEQ ID NO: 1.
21. ASO according to any one of claims 1 to 19, characterized in that the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising (i) nucleotides 675-792 of SEQ ID NO: 1; (ii) nucleotides 1,448 - 59,705 of SEQ ID NO: 1; (iii) nucleotides 61,867 - 104,675 of SEQ ID NO: 1; (iv) nucleotides 112,212 - 117,971 of SEQ ID NO: 1; (v) nucleotides 119,490 - 135,169 of SEQ ID NO: 1; (vi) nucleotides 137,637 - 157,806 of SEQ ID NO: 1; (vii) nucleotides
159,241 - 266,124 of SEQ ID NO: 1; or (viii) nucleotides 272,838 -
310,899 of SEQ ID NO: 1.
22. ASO according to any one of claims 1 to 19, characterized in that the contiguous nucleotide sequence is complementary to a nucleic acid sequence comprising (i) nucleotides 725 - 742 of SEQ ID NO: 1; (ii) nucleotides 1,498 - 59,655 of SEQ ID NO: 1; (iii) nucleotides 61,917 - 104,625 of SEQ ID NO: 1; (iv) nucleotides 112,262 - 117,921 of SEQ ID NO: 1; (v) nucleotides 119,540 - 135,119 of SEQ ID NO: 1; (vi) nucleotides 137,687 - 157,756 of SEQ ID NO: 1; (vii) 159,291 -
266,074 of SEQ ID NO: 1; or (viii) nucleotides 272,888 - 310,849 of SEQ ID NO: 1.
23. ASO according to any of the claims
1 to 22, characterized by the fact that the contiguous nucleotide sequence comprises SEQ ID NO: 4 to SEQ ID NO: 1713 with one or two incompatibilities.
24. ASO according to any one of claims 1 to 23, characterized in that the contiguous nucleotide sequence comprises the nucleotide sequence selected from the sequences in Figures 1A and 1B (SEQ ID NO: 4 to SEQ ID NO: 1713) .
25. ASO according to any one of claims 1 to 24, characterized in that the contiguous nucleotide sequence comprises SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 114, SEQ ID NO: 158, SEQ ID NO: 190, SEQ ID NO: 327, SEQ ID NO: 463, SEQ ID NO: 513, SEQ ID NO: 516, SEQ ID NO: 519, SEQ ID NO: 657, SEQ ID NO: 659, SEQ ID NO : 827, SEQ ID NO: 1249, SEQ ID NO: 1326, SEQ ID NO: 1409, SEQ ID NO: 1524, SEQ ID NO: 1530, SEQ ID NO: 1662 or SEQ ID NO: 1676.
26. ASO according to any one of claims 1 to 24, characterized in that the contiguous nucleotide comprises SEQ ID NO: 55, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 71, SEQ ID NO : 75, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 92, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 128, SEQ ID NO: 130 , SEQ ID NO: 133, SEQ ID NO: 138, SEQ ID NO: 161, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 186, SEQ ID NO: 195, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 234, SEQ ID NO: 264, SEQ ID NO: 387, SEQ ID NO: 390, SEQ ID NO: 396, SEQ ID NO: 441, SEQ ID NO: 446, SEQ ID NO : 457, SEQ ID NO: 467, SEQ ID NO: 523, SEQ ID NO: 524, SEQ ID NO: 636, SEQ ID NO: 640, SEQ ID NO: 700, SEQ ID NO: 740, SEQ ID NO: 832 , SEQ ID NO: 965, SEQ ID NO: 1015, SEQ ID NO: 1065, SEQ ID NO: 1071, SEQ ID NO: 1155, SEQ ID NO: 1475, SEQ ID NO: 1508, SEQ ID NO: 1685, SEQ ID NO: 1686, SEQ ID NO: 1687, SEQ ID NO: 1688, or SEQ ID NO: 1690.
27. ASO according to claim 1 or 26, characterized by the fact that it has a design selected from the group consisting of the designs in Figure 3, in which the capital letter is a sugar-modified nucleoside and the lower letter is DNA.
28. ASO according to any one of claims 1 to 27, characterized in that it is capable of reducing the expression of the CAMK2D protein in a hiPSC-CM cell that expresses the CAMK2D protein.
29. ASO according to claim 28, characterized in that the expression of the CAMK2D protein is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50% at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% compared to a cell not exposed to ASO.
30. ASO according to any of claims 1 to 29, characterized in that it is capable of reducing the expression of the CAMK2D transcription (e.g., mRNA) in a hiPSC-CM cell that expresses the CAMK2D transcription.
31. ASO according to claim 30, characterized in that the expression of the CAMK2D transcript is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50 %, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a cell not exposed to ASO.
32. ASO according to any one of claims 1 to 31, characterized in that it is 14 to 20 nucleotides in length.
33. ASO according to any one of claims 1 to 32, characterized in that the nucleotide sequence comprises one or more modified internucleoside bonds.
34. ASO according to any one of claims 1 to 33, characterized in that one or more modified internucleoside bonds is a phosphorothioate bond.
35. ASO according to claim 33 or 34, characterized by the fact that at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of internucleoside bonds are modified .
36. ASO according to claim 35, characterized by the fact that each of the internucleoside bonds in the ASO is a phosphorothioate bond.
37. Conjugate comprising the ASO as defined in any one of claims 1 to 36, characterized in that the ASO is covalently linked to at least one non-nucleotide or non-polynucleotide moiety.
38. Conjugate according to claim 37, characterized in that the non-nucleotide or non-polynucleotide moiety comprises a protein, a fatty acid chain, a sugar residue, a glycoprotein, a polymer, or any combination thereof.
39. Pharmaceutical composition, characterized in that it comprises ASO as defined in any one of claims 1 to 36, or the conjugate as defined in claim 37 or 38, and a pharmaceutically acceptable diluent, carrier, salt or adjuvant.
40. Pharmaceutical composition according to claim 39, characterized in that the pharmaceutically acceptable salt comprises a sodium salt, a potassium salt, an ammonium salt, or any combination thereof.
41. Pharmaceutical composition according to claim 39 or 40, characterized in that it further comprises at least one other therapeutic agent.
42. Pharmaceutical composition according to claim 41, characterized in that the other therapeutic agent is a CAMK2D antagonist.
43. Pharmaceutical composition according to claim 42, characterized in that the CAMK2D antagonist is an anti-CAMK2d antibody or fragment thereof.
44. Kit, characterized in that it comprises the ASO as defined in any one of claims 1 to 36, the conjugate as defined in claim 37 or 38, or the pharmaceutical composition as defined in any of claims 39 to 43, and instructions of use.
45. Diagnostic kit, characterized in that it comprises the ASO as defined in any one of claims 1 to 36, the conjugate as defined in claim 37 or 38, or the pharmaceutical composition as defined in any of claims 39 to 43, and instructions for use.
46. Method for inhibiting or reducing the expression of the CAMK2D protein in a cell, said method characterized by the fact that it comprises the administration of ASO as defined in any one of claims 1 to 36, of the conjugate as defined in claim 37 or 38, or of the pharmaceutical composition as defined in any one of claims 39 to 43, to the cell expressing the CAMK2D protein, wherein the expression of the CAMK2D protein in the cell is inhibited or reduced after administration.
47. In vitro method for inhibiting or reducing the expression of the CAMK2D protein in a cell, characterized in that it comprises contacting the ASO as defined in any one of claims 1 to 36, the conjugate as defined in claim 37 or 38, or The pharmaceutical composition as defined in any one of claims 39 to 43, to the cell expressing the CAMK2D protein, wherein the expression of the CAMK2D protein in the cell is inhibited or reduced after contact.
48. Method according to claim 46 or 47, characterized in that ASO inhibits or reduces the expression of CAMK2D transcription (e.g., mRNA) in the cell after administration.
49. Method according to claim 48, characterized in that the expression of the CAMK2D transcription (for example, mRNA) is reduced by at least about 20%, at least about 30%, at least about 40% at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% after administration compared to a non-cell exposed to ASO.
50. Method according to any of claims 46 to 49, characterized in that the expression of the CAMK2D protein is reduced by at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% after administration compared to a cell not exposed to ASO.
51. Method according to any of claims 46 to 50, characterized in that the cell is a cardiac cell, for example, hiPSC-CM.
52. Method for reducing, ameliorating or treating one or more symptoms of a cardiovascular disease or disorder in an individual in need, said method characterized by the fact that it comprises administering an effective amount of ASO as defined in any one of claims 1 to 36, the conjugate as defined in claim 37 or 38, or the pharmaceutical composition as defined in any of claims 39 to 43, to the individual.
53. Use of ASO as defined in any of claims 1 to 36, of conjugate as defined in claim 37 or 38, or of pharmaceutical composition as defined in any of claims 39 to 43, said use characterized by the fact that it is for the manufacture of a medicine.
54. Use of ASO as defined in any one of claims 1 to 36, of conjugate as defined in claim 37 or 38, or of pharmaceutical composition as defined in any of claims 39 to 43, said use characterized by the fact that it is for the manufacture of a drug for the treatment of a cardiovascular disease or disorder in an individual in need.
55. ASO according to any one of claims 1 to 36, conjugated as defined in claim 37 or 38, or pharmaceutical composition as defined in any of claims 39 to 43, characterized in that it is for use in therapy.
56. ASO according to any one of claims 1 to 36, conjugated as defined in claim 37 or 38, or pharmaceutical composition as defined in any of claims 39 to 43, characterized in that it is for use in the therapy of a disease or cardiovascular disorder in an individual in need.
57. ASO according to claim 19, method as defined in claim 52, use as defined in claim 54, or ASO for use as defined in claim 56, characterized in that the cardiovascular disease or disorder comprises coronary artery disease , stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, cardiac arrhythmia, congenital heart disease, valvular heart disease carditis, aortic aneurysms, peripheral arterial disease, thromboembolic disease, venous thrombosis, or any combination thereof.
58. Method, use or ASO according to claim 57, characterized by the fact that the cardiovascular disease or disorder is heart failure.
59. Method, use or ASO according to claim 58, characterized by the fact that heart failure comprises heart failure on the left side, heart failure on the right side, congestive heart failure, heart failure with reduced ejection fraction (HFrEF), heart failure with preserved ejection fraction (HFpEF), heart failure with intermediate range ejection fraction (HFmrEF), hypertrophic cardiomyopathy (HCM), hypertensive heart disease (HHD), or hypertrophic hypertensive cardiomyopathy.
60. Method according to any of claims 52 and 57 to 59, use as defined in any of claims 54 and 57 to 59, or ASO for use as defined in any of claims 56 to 59, characterized by the fact that the individual is a human being.
61. Method according to any of claims 52 and 57 to 60, use as defined in any of claims 54 and 57 to 60, or ASO for use as defined in any of claims 56 to 60, characterized in that ASO, conjugate or pharmaceutical composition is administered intracardiac, oral, parenteral, intrathecal, intracerebroventricular, pulmonary, topical or intraventricular.
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 6/112 1/103
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 7/112 2/103
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 8/112 3/103
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 9/112 4/103
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 10/112 5/103
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 11/112 6/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 12/112 7/103
Start End (SEQ ID (SEQ ID ASO ASO Sequence with Chemical Structure NO: 1) NO: 1)
Petition 870200163011, of 12/30/2020, p. 13/112 8/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 14/112 9/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 1/15/12 10/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 1/16 12/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 17/112 10/123
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 18/112 10/13
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 19/112 10/14
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 1/20 12/10/15
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 21/112 10/163
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 22/112 10/17
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 23/112 10/183
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 24/112 10/193
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 25/112 10/20
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 26/112 10/21
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 27/112 10/22
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 28/112 10/23
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 29/112 10/24
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 1/30 12/25
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 1/31 12/263
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 32/112 10/27
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 33/112 10/28
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 34/112 10/29
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 35/112 10/30
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 36/112 10/31
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 37/112 32/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 38/112 33/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 39/112 34/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 40/112 35/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 41/112 36/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 42/112 37/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 43/112 38/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 44/112 39/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 45/112 40/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 46/112 41/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 47/112 42/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 48/112 43/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 49/112 44/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 50/112 45/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 51/112 46/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 52/112 47/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 53/112 48/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 54/112 49/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 55/112 50/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 56/112 51/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 57/112 52/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 58/112 53/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 59/112 54/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 60/112 55/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 61/112 56/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 62/112 57/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 63/112 58/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 64/112 59/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 65/112 60/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 66/112 61/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 67/112 62/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 68/112 63/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 69/112 64/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 70/112 65/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 71/112 66/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 72/112 67/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 73/112 68/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 74/112 69/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 75/112 70/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 76/112 71/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 77/112 72/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 78/112 73/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 79/112 74/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 80/112 75/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 81/112 76/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 82/112 77/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 83/112 78/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 84/112 79/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 85/112 80/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 86/112 81/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 87/112 82/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 88/112 83/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 89/112 84/103
Start End (SEQ ID (SEQ ID Sequence ASO NO: 1) ASO with Chemical Structure NO: 1)
Petition 870200163011, of 12/30/2020, p. 90/112 85/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 91/112 86/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 92/112 87/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 93/112 88/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 94/112 89/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 95/112 90/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 96/112 91/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 97/112 92/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 98/112 93/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 99/112 94/103
Start # 1. End # 1. Home # 2. End # 2. Home # 3. End # 3. (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: (SEQ ID NO: ASO ASO sequence with Chemical Structure ID NO: 1) ID NO: 1) ID NO: 1 ) ID NO: 1) ID NO: 1) ID NO: 1)
Petition 870200163011, of 12/30/2020, p. 100/112 95/103
Petition 870200163011, of 12/30/2020, p. 101/112 HEK293 cells, 25 µM oligo treatment 3-day gymnosis 96/103 CAMK2D mRNA rel.
GAPDH (% UTC) Position of human transcription (ID XX)
Start End (SEQ ID (SEQ ID No.
ASO with Design No.
ASO NO: 1) NO: 1) DES
Start End (SEQ ID (SEQ ID No.
ASO with Design No.
ASO NO: 1) NO: 1) DES
Start End (SEQ ID (SEQ ID No.
ASO with Design No.
ASO NO: 1) NO: 1) DES
Start End (SEQ ID (SEQ ID No.
ASO with Design No.
ASO NO: 1) NO: 1) DES
Start End (SEQ ID (SEQ ID No.
ASO with Design No.
ASO NO: 1) NO: 1) DES
Single point, 25 µM, Single point, 500 nM, human iPSC-CM, HEK293, mRNA,% UTC mRNA,% UTC

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112020016347A2|2021-01-12|CAMK2D ANTISENSE OLIGONUCLEOTIDS AND THEIR USES

---

EP3253875B1|2020-01-08|Tau antisense oligomers and uses thereof

---

US20180023081A1|2018-01-25|Lna oligonucleotides with alternating flanks

---

TWI660968B|2019-06-01|Antagonat compositions and methods of use

---

BR112016029369B1|2020-12-08|antisense oligomer, pharmaceutical composition use of an antisense oligomer or a pharmaceutically acceptable salt or hydrate thereof, and methods for making and screening an antisense oligomer

---

JP2019500346A|2019-01-10|Compositions and methods for the treatment of kidney disease

---

JP6983343B2|2021-12-17|Antisense-oligonucleotide as a TGF-R signaling inhibitor

---

BR122020018622A2|2021-02-09|NUCLEIC ACID MOLECULE FOR REDUCING PAPD5 AND PAPD7 OF MRNA FOR THE TREATMENT OF HEPATITIS B INFECTION

---

KR20210121199A|2021-10-07|Oligonucleotide compositions and methods thereof

---

JP5794559B2|2015-10-14|Drugs for regulating differentiation of mesenchymal cells and use thereof

---

CA3142526A1|2020-12-10|Oligonucleotides and methods of use for treating neurological diseases

---

BR112020020220A2|2021-01-19|USE OF FUBP1 INHIBITORS TO TREAT HEPATITIS B VIRUS INFECTION

---

JP2021529525A|2021-11-04|Oligonucleotide for TAU expression regulation

---

CN113785060A|2021-12-10|Oligonucleotides for modulating expression of ATXN2

---

US20210378652A1|2021-12-09|Camk2d antisense oligonucleotides and uses thereof

---

JP2022519019A|2022-03-18|Oligonucleotide composition and its method

---

US20210095285A1|2021-04-01|Methods for treating brain injury

---

WO2020206115A2|2020-10-08|Angptl2 antisense oligonucleotides and uses thereof

---

WO2021231210A1|2021-11-18|Complement component c1r inhibitors for treating a neurological disease, and related compositions, systems and methods of using same

同族专利:

---

公开号 | 公开日

---

US11083444B2|2021-08-10|

---

IL276549D0|2020-09-30|

---

SG11202007652UA|2020-09-29|

---

CN112020559A|2020-12-01|

---

AU2019226001A1|2020-09-03|

---

EP3755800A1|2020-12-30|

---

WO2019165067A1|2019-08-29|

---

JP2021513861A|2021-06-03|

---

KR20200140805A|2020-12-16|

---

US20190321022A1|2019-10-24|

---

CA3091789A1|2019-08-29|

---

US11058767B2|2021-07-13|

---

US20190275148A1|2019-09-12|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3749088A|1971-06-23|1973-07-31|W Kohlmann|Surgical retractor device|

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

DE69233046T2|1991-10-24|2004-03-04|Isis Pharmaceuticals, Inc., Carlsfeld|DERIVATIZED OLIGONUCLEOTIDS WITH IMPROVED CAPACITY|

---

AT361990T|1996-11-13|2007-06-15|Qbi Entpr Ltd|GENIDENTIFIKATIONSVERFAHREN|

---

JP3756313B2|1997-03-07|2006-03-15|武 今西|Novel bicyclonucleosides and oligonucleotide analogues|

---

CA2303299C|1997-09-12|2016-02-23|Exiqon A/S|Oligonucleotide analogues|

---

US6139493A|1998-07-08|2000-10-31|Koros; Tibor B.|Retractor with adjustable length blades and light pipe guides|

---

EP1152009B2|1999-02-12|2017-09-06|Daiichi Sankyo Company, Limited|Novel nucleosides and oligonucleotide analogues|

---

DE60033927T2|1999-05-04|2007-11-29|Santaris Pharma A/S|L-RIBO-LNA ANALOGUE|

---

US6617442B1|1999-09-30|2003-09-09|Isis Pharmaceuticals, Inc.|Human Rnase H1 and oligonucleotide compositions thereof|

---

GB2375172A|2000-02-07|2002-11-06|Quark Biotech Inc|Fas pathway genes|

---

EP1355578A1|2001-01-29|2003-10-29|Stephen Ritland|Retractor and method for spinal pedicle screw placement|

---

US9259144B2|2002-07-11|2016-02-16|Nuvasive, Inc.|Surgical access system and related methods|

---

WO2003016475A2|2001-08-14|2003-02-27|The General Hospital Corporation|Nucleic acid and amino acid sequences involved in pain|

---

WO2003039443A2|2001-11-05|2003-05-15|Deutsches Krebsforschungszentrum|Novel genetic markers for leukemias|

---

JP2005522999A|2002-01-31|2005-08-04|ミレニアム・ファーマシューティカルズ・インコーポレイテッド|Methods and compositions for treating cancer|

---

AU2003255337A1|2002-07-31|2004-02-23|Kylix B.V.|Use of genes identified to be involved in tumor development for the development of anti-cancer drugs|

---

WO2004033476A1|2002-10-11|2004-04-22|Ahram Biosystems Inc.|Target detection system having a conformationally sensitive probe comprising a nucleic acid based signal transducer|

---

US7850608B2|2002-10-25|2010-12-14|K2M, Inc.|Minimal incision maximal access MIS spine instrumentation and method|

---

AT442152T|2002-11-18|2009-09-15|Santaris Pharma As|Antisense DRAFT|

---

US20040101855A1|2002-11-22|2004-05-27|Isis Pharmaceuticals Inc.|Modulation of PPAR binding protein expression|

---

US7691057B2|2003-01-16|2010-04-06|Nuvasive, Inc.|Surgical access system and related methods|

---

US7256200B2|2003-02-10|2007-08-14|The Board Of Trustees Of The University Of Illinois, A Body Corporate And Politic Of The State Of Illinois|Method and composition for potentiating an oplate analgesic|

---

US7819801B2|2003-02-27|2010-10-26|Nuvasive, Inc.|Surgical access system and related methods|

---

US20050085436A1|2003-07-08|2005-04-21|Hao Li|Method to treat conditions associated with insulin signalling dysregulation|

---

US7481766B2|2003-08-14|2009-01-27|Synthes |Multiple-blade retractor|

---

US20050137461A1|2003-12-18|2005-06-23|Depuy Spine, Inc.|Telescoping blade assembly and instruments for adjusting an adjustable blade|

---

WO2005060667A2|2003-12-19|2005-07-07|The General Hospital Corporation|Nucleic acid and amino acid sequences involved in pain|

---

US7374927B2|2004-05-03|2008-05-20|Affymetrix, Inc.|Methods of analysis of degraded nucleic acid samples|

---

WO2006042241A2|2004-10-08|2006-04-20|Nuvasive, Inc.|Surgical access system and related methods|

---

JP2006223228A|2005-02-18|2006-08-31|Dainippon Sumitomo Pharma Co Ltd|Method for screening therapeutic agent for autoimmune disease|

---

US20060287584A1|2005-06-16|2006-12-21|Javier Garcia-Bengochia|Surgical retractor extensions|

---

CN1904900A|2005-07-28|2007-01-31|中国科学院生物物理研究所|Human autogenous siRNA sequence, its application and screening method|

---

WO2007031091A2|2005-09-15|2007-03-22|Santaris Pharma A/S|Rna antagonist compounds for the modulation of p21 ras expression|

---

CA2630200A1|2005-11-18|2007-05-24|Johannes Backs|Uses for camki i and hdacs in the treatment of heart conditions|

---

KR20130042043A|2006-01-27|2013-04-25|아이시스 파마수티컬즈 인코포레이티드|6-modified bicyclic nucleic acid analogs|

---

WO2007143316A2|2006-05-05|2007-12-13|Isis Pharmaceuticals, Inc.|Compounds and methods for modulating expression of sglt2|

---

WO2007101306A1|2006-03-07|2007-09-13|Telethon Institute For Child Health Research|Method for diagnosing and/or predicting the development of an allergic disorder and agents for treating and/or preventing same|

---

WO2007134181A2|2006-05-11|2007-11-22|Isis Pharmaceuticals, Inc.|5'-modified bicyclic nucleic acid analogs|

---

US7666854B2|2006-05-11|2010-02-23|Isis Pharmaceuticals, Inc.|Bis-modified bicyclic nucleic acid analogs|

---

WO2008020435A2|2006-08-15|2008-02-21|Quark Pharmaceuticals, Inc|Compositions and methods for treatment of mood disorders|

---

EP2061482B1|2006-08-28|2015-01-07|The University Of Western Australia|Method of modulation of expression of epidermal growth factor receptor involving miRNA|

---

GB0617222D0|2006-08-31|2006-10-11|Vereniging Het Nl Kanker I|Antibiotics|

---

DK2149605T3|2007-03-22|2013-09-30|Santaris Pharma As|Short RNA antagonist compounds to modulate the desired mRNA|

---

US8062217B2|2007-01-26|2011-11-22|Theken Spine, Llc|Surgical retractor with removable blades and method of use|

---

ES2388590T3|2007-05-30|2012-10-16|Isis Pharmaceuticals, Inc.|Analogs of bicyclic nucleic acids with N-substituted aminomethylene bridge.|

---

US8278426B2|2007-06-08|2012-10-02|Isis Pharmaceuticals, Inc.|Carbocyclic bicyclic nucleic acid analogs|

---

WO2008152636A2|2007-06-15|2008-12-18|Quark Pharmaceuticals, Inc.|Compositions and methods for inhibiting nadph oxidase expression|

---

CN101796062B|2007-07-05|2014-07-30|Isis制药公司|6-disubstituted bicyclic nucleic acid analogs|

---

DE202007012284U1|2007-09-01|2007-10-25|Aesculap Ag & Co. Kg|Surgical retractor|

---

US8546556B2|2007-11-21|2013-10-01|Isis Pharmaceuticals, Inc|Carbocyclic alpha-L-bicyclic nucleic acid analogs|

---

US8841423B2|2008-04-28|2014-09-23|University Of Iowa Research Foundation|Monoclonal antibodies specific for oxidized calcium/calmodulin dependent protein kinase II|

---

WO2010036698A1|2008-09-24|2010-04-01|Isis Pharmaceuticals, Inc.|Substituted alpha-l-bicyclic nucleosides|

---

EP2177615A1|2008-10-10|2010-04-21|Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V.|Method for a genome wide identification of expression regulatory sequences and use of genes and molecules derived thereof for the diagnosis and therapy of metabolic and/or tumorous diseases|

---

US8226554B2|2008-10-30|2012-07-24|Warsaw Orthopedic, Inc.|Retractor assemblies for surgery in a patient|

---

WO2010120969A1|2009-04-15|2010-10-21|Board Of Regents, The University Of Texas System|Targeting of the mir-30 family and let-7 family as a treatment for heart disease|

---

US8563528B2|2009-07-21|2013-10-22|Santaris Pharma A/S|Antisense oligomers targeting PCSK9|

---

US9012421B2|2009-08-06|2015-04-21|Isis Pharmaceuticals, Inc.|Bicyclic cyclohexose nucleic acid analogs|

---

US9364495B2|2009-10-20|2016-06-14|Roche Innovation Center Copenhagen A/S|Oral delivery of therapeutically effective LNA oligonucleotides|

---

US9737288B2|2010-03-11|2017-08-22|Globus Medical, Inc|Tissue retractor and methods of use|

---

EP2580228B1|2010-06-08|2016-03-23|Ionis Pharmaceuticals, Inc.|Substituted 2'-amino and 2'-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom|

---

WO2012024255A2|2010-08-16|2012-02-23|Duke University|Camkk-beta as a target for treating cancer|

---

EP3778896A1|2011-08-09|2021-02-17|Fred Hutchinson Cancer Research Center|Methods and compositions for inhibiting the growth and/or proliferation of myc-driven tumor cells|

---

EP3453761A1|2011-08-29|2019-03-13|Ionis Pharmaceuticals, Inc.|Oligomer-conjugate complexes and their use|

---

US9603949B2|2011-09-01|2017-03-28|University Of Iowa Research Foundation|Oligonucleotide-based probes for detection of bacterial nucleases|

---

CA2857374A1|2011-09-02|2013-03-07|The Trustees Of Columbia University In The City Of New York|Camkii, ip3r, calcineurin, p38 and mk2/3 inhibitors to treat metabolic disturbances of obesity|

---

CN104136451A|2011-09-07|2014-11-05|玛瑞纳生物技术有限公司|Synthesis and uses of nucleic acid compounds with conformationally restricted monomers|

---

WO2013151999A1|2012-04-02|2013-10-10|President And Fellows Of Harvard College|Cancer treatment and immune system regulation through fat10 pathway inhibition|

---

EP2850092B1|2012-04-09|2017-03-01|Ionis Pharmaceuticals, Inc.|Tricyclic nucleic acid analogs|

---

EP2850184A4|2012-05-16|2016-01-27|Rana Therapeutics Inc|Compositions and methods for modulating gene expression|

---

CN105358692B|2013-06-27|2020-08-21|罗氏创新中心哥本哈根有限公司|Antisense oligomers and conjugates targeting PCSK9|

---

CN104884618A|2012-11-15|2015-09-02|罗氏创新中心哥本哈根有限公司|Oligonucleotide conjugates|

---

WO2014077693A1|2012-11-16|2014-05-22|Academisch Ziekenhuis Leiden H.O.D.N. Lumc|Means and methods for reducing an effect of aging in a mammalian cell|

---

JP6318180B2|2013-03-06|2018-04-25|アロステロス セラピューティクス， インコーポレイテッド|CaMKII inhibitor and use thereof|

---

RS58981B1|2013-05-01|2019-08-30|Ionis Pharmaceuticals Inc|Compositions and methods for modulating hbv and ttr expression|

---

US20140329755A1|2013-05-01|2014-11-06|Gilead Sciences, Inc.|Combination therapy for the treatment of arrhythmias or heart failure|

---

WO2016037106A1|2014-09-05|2016-03-10|Allosteros Therapeutics, Inc|CaMKII INHIBITORS AND USES THEREOF|

---

US10494646B2|2015-02-02|2019-12-03|Meiragtx Uk Ii Limited|Regulation of gene expression by aptamer-mediated modulation of alternative splicing|

---

JP2018512876A|2015-04-22|2018-05-24|ミナ セラピューティクス リミテッド|saRNA compositions and methods of use|

---

US10494632B2|2015-07-10|2019-12-03|Alnylam Pharmaceuticals, Inc.|Insulin-like growth factor binding protein, acid labile subunit compositions and methods of use thereof|

---

EP3353305A4|2015-09-25|2019-09-18|Ionis Pharmaceuticals, Inc.|Conjugated antisense compounds and their use|

---

US11116843B2|2015-09-25|2021-09-14|Ionis Pharmaceuticals, Inc.|Conjugated antisense compounds and their use|

---

EP3389672A4|2015-12-14|2019-08-14|Cold Spring Harbor Laboratory|Compositions and methods for treatment of liver diseases|

---

EP3481857A1|2016-07-06|2019-05-15|Crispr Therapeutics AG|Materials and methods for treatment of pain related disorders|

---

MX2019001239A|2016-08-03|2019-07-04|Meiragtx Uk Ii Ltd|High throughput cell-based screening for aptamers.|

---

US20200215147A1|2017-09-10|2020-07-09|Carmel Haifa University Economic Corporation Ltd.|Methods for treating depression and major depressive disorder|

---

WO2019143847A1|2018-01-18|2019-07-25|Advanced ReGen Medical Technologies, LLC|Therapeutic compositions and methods of making and using the same|

---

US11058767B2|2018-02-21|2021-07-13|Bristol-Myers Squibb Company|CAMK2D antisense oligonucleotides and uses thereof|

---

CN112400018A|2018-05-07|2021-02-23|阿尔尼拉姆医药品有限公司|Extrahepatic delivery|WO2006058221A2|2004-11-24|2006-06-01|Abdou Samy M|Devices and methods for inter-vertebral orthopedic device placement|

---

US8764806B2|2009-12-07|2014-07-01|Samy Abdou|Devices and methods for minimally invasive spinal stabilization and instrumentation|

---

US9320617B2|2012-10-22|2016-04-26|Cogent Spine, LLC|Devices and methods for spinal stabilization and instrumentation|

---

US10857003B1|2015-10-14|2020-12-08|Samy Abdou|Devices and methods for vertebral stabilization|

---

US10898175B2|2016-10-04|2021-01-26|Jgmg Bengochea, Llc|Retractor extension clip systems|

---

US10744000B1|2016-10-25|2020-08-18|Samy Abdou|Devices and methods for vertebral bone realignment|

---

US10973648B1|2016-10-25|2021-04-13|Samy Abdou|Devices and methods for vertebral bone realignment|

---

US11058767B2|2018-02-21|2021-07-13|Bristol-Myers Squibb Company|CAMK2D antisense oligonucleotides and uses thereof|

---

US11179248B2|2018-10-02|2021-11-23|Samy Abdou|Devices and methods for spinal implantation|

---

KR20200071198A|2018-12-10|2020-06-19|네오이뮨텍, 인코퍼레이티드|Development of new adoptive T cell immunotherapy by modification of Nrf2 expression|

---

US11253243B2|2019-06-18|2022-02-22|Nuvasive, Inc.|Tissue retraction system|

---

CN110731803B|2019-11-20|2021-05-25|吕振乾|Heart surgical operation assistor|

---

WO2021158810A1|2020-02-05|2021-08-12|Bristol-Myers Squibb Company|Oligonucleotides for splice modulation of camk2d|

---

US11224415B1|2020-07-10|2022-01-18|Warsaw Orthopedic, Inc.|Tissue retractor|

法律状态:
2021-12-14| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201862633502P| true| 2018-02-21|2018-02-21|

---

US62/633,502|2018-02-21|

---

US201862635954P| true| 2018-02-27|2018-02-27|

---

US62/635,954|2018-02-27|

---

US201862665998P| true| 2018-05-02|2018-05-02|

---

US62/665,998|2018-05-02|

---

US201862778679P| true| 2018-12-12|2018-12-12|

---

US62/778,679|2018-12-12|

---

PCT/US2019/018947|WO2019165067A1|2018-02-21|2019-02-21|Camk2d antisense oligonucleotides and uses thereof|

---